Description :
From Genome Similarity Track
Location :
Scaffold_411:1549- 3021
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_411-snap-gene-0.8Phospholipase D, Pi-sPLD-like-9

Sequence
1472 bases(100 bases per row)
CGAAAGAACCGGCGGACCAGCCAGAGCTGGATGCAAACAAATGGTTCCTGACGGAGAGCGAGATGACCAAGTCGCGCGGCGGCGTCGCGCGTAATGAACT
CGCACTGGCATCACATAACAACACCGTGACCACGTTCGTTGCCACAAGTGAGTTCTTCGATTCGGTCTACACTGACTTTCTCGCAGTTAAGAAGCATGAC
CACGTGTGGATTACTGGGTGGAGCTTCGACGATGTCtCGCTGAAGCCACAGGTCGAGAGTGATAAACTAAATGACACTCTCCTGGTCGCGATGCTCCAGA
GAATGGTCGACAAACGGGTCGATCTCCATGTACTTGGATGGAACAACTTCTTCGAGGCAGAGCAGAATATGAAGGCTCAGGAAATGATCAACGCACTGCA
GCCACTACCACCGCAAGGGGGCGCGTACTTTGTGTTCGACGATCGTGTGCCTGATGCGACATCATCACACCACCAGAAGACAATCGCCATCAAGCGAGAG
GAGGGCATTGTGGCCTATGTTGGCGGGATCGATCTAACGTGGGATCGCTGGGATACTATTACCCACGATGCTTCTGAAcTGCGGAAGCGCACGAATGTGC
AGCGTGTCGAGAGTTCGAAGGGATGGATGGACGCACATGTGAAGATCGATGGGCCAGCTGCGAAGGACATTGCCGCCAACTTTCTCCAGCGCTGGAATGC
CAAGGAGAAACCCCTCCAAGACTTGCTTGACCCGCTGTTTTCATTCGAGAATCCGGAGTACTCGCCGCTCGCTCCTCTGACGAGAGGAGAGCCTCTGATT
GAGCGCACAAGTGGTCATCATGCGGTTCAGATCGTGCGCACATACAGCTGTGGCTCcGAGCATTTTGATGAGTTCGCTCCACACGGTGAAGTCTCGTTAT
TTCACGCCCGTCTGAAGGCAATCAAAATGGCGAAGAATTACATCTACATCGAAGACCAGTATCTGATTTTtGTTCCCCAGCTTCTTGACGCACTGATGGA
GGTGTTACCGCGCcTGCAGCGCCTTATCATCCTAGCTCAACGCCCAAGCTCTAGCACACGCCTCACGGGATACAAGAAGTACCAATTCGAGATGTTCACA
CCACTCCAGGAGCGTTTCCCCAACAAAGTCCAGATCTACGCAACTAAAGAGtcTCGAGGTGTCTACGTGCACAGCAAGTTCCTAcTCATCGACGATGTTT
TCCTCACCATCGGCTCCGCGAACTGGAACCGCCGAAGCATGACTGCCGACAGTGAAGTCGCTGCAAACATTGTGGATGCCAAATCCATCCTCGCGCCGGA
GGGGATTTATGTCAATGCGTTGGCACGCGACTACCGCATCCGCAAGTTCATGGAGTTAATTGGCAAGAGCTACGATGAACTGGACAAACTCACGTTGCTC
CAGGCTGCGAACGCACTCGACGAGGCAGCAAAGCAGCCCAACACGCTCATCGAGCAGTACCAGGTCGTGAAG