Description :
From Genome Similarity Track
Location :
Scaffold_1:1548867- 1550824
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00395lipase

Sequence
1957 bases(100 bases per row)
CCGTAGCTAGTGTCATTGCCCGGTCGGCCACGAAGCGTGGCGGGGATGCCTATCTGCGGAATGTCGGGGTACATCTTCAACACCACCTCAGCCTCATCGT
CGCTGTAGCCCATGGTTCCAACCAGGTACTCATAGAACTGCTCAGTCGTGTTAATGCCCGTCTTGCCGAACGCAGTACCCTCATCAAAATTGGCGCCGTG
CAGGATTGGCACGTGCACGAACTTGCCTTCACCGATGAGCTTTGGCCCAACGTCCGTCAGAAAGTCACCGTCGACAGACGGCGCATACATCGCCGACGTA
GCCGCCGAACTATTGAAAACGGCCGATAACGTGTCAATCGGGACCTGGCGGAGGCATTCAAGGGTGTCTTCCGCAGAGCTGCAGTTCGTGGCATCAGTGA
TGCTGTTGTAATGGACGTTCCAGGCAGAGGCGTTCTTGAAGCTCTTGGGCCAGTAAGCCGAAGCACCCGACTGCATCACAGCGCTACGGAACAGACCGTC
GTCGCGGCCGTCGTAGGCGATCAGCTGGTAGCCGATACTGCGCGCACCAGCACTCTCACCCCAAATCGTGACCTTGCTGGCGTCTCCGCCGAATGCGGCG
ATGTTCTCTTGCACCCAGTGCAAGGCCAGACGTTGGTCCTTCAGCGCGAGGTTGGCCACACTGGCCTTGTGCACAGCGGTGCCCGACATGAACCCGAAGG
CCTGGAGACGATAGTTAAAGCTGACGCCGACGAACGGTTTACCCGCTGCCGCAGCTTCCTCGATGATGTAAGACAGGTTGTAACGAGGGTCACGGGCACC
ACCTTGGACAAGACCTCCGCCATAAATCCACACCCCGACAGGCAGATCGTCCCCTTCAGAGACGTTGCTCGGACGAACCACGTTTATCGTTAAGCAGTCC
TCCGAAATGATGTTGCCCAGCACCCACTGGTCACTGCCATATCCGTAGCACTCGGGAGAGTACTCTGTCGCGTTCTTGGAGTCCGTCCACGTCGTGTTGA
GAGGTTCTGGGTTGCGGAAGCGGAGATCGCCGACAGGCGGCTGCGCGTAGGGCATTCCGAGGAAGAGATCCTGGTCGTACGTGGGCTGGTAGACACCGTA
GTAAGAGCCATTCTTAATGGTGACTGTCGGCACATCCAAGGCAGTGATTGGTGTGACCACTAGCGCAGCAGCCACGACTGGGACCAAAAGCGAGCGCATG
GCGGAGGAGTGAAACAGGACGACCGTCGACTGGTATTGCGCTTGCGAGAAAGACGAAAAGTGAAGCAGTGAGTCAATCACCACGGCATGCTCTGCGTCGG
CGCTTCTGTTGCGCTCGCGCTGGTGGATTGCCGCCGCCGGCGGCCCTGAAGGTCCGCAAAAACGAGACGTGAACAACTGCAACTTGAGCTCAATCCCTTC
GGATTTGTTCGAGGCATTGGTGGCGCTGCGGATTTTGGGGCAACTCAATGAGCATGTCTAGGTGATCAATTTGCACTAGACAGCGATGTACATAGCAGTA
AGCTATAATAGCATCATGTATGCTTAAGTTTGAACGACGACAGCTAAGATACAGGTACCATGTAGATCAACCGAAGATTGATCCTATGGATCTGTCTTCG
TCCACAGACACACTGCACCAGTTTTGACAATCGAGCCCTGTGCTTGTTGCTCGCGATTTGCTTCGTGGTTGAAGCAGGAAAGTCCCAGTTGAAGCGGTAC
TGATGAGGACAGGGCAAGGAGTGACAACGACAGCCTCGCCTCGTGCACATTTGCATCGAGCAATCGATGGCAATCTTTCTCTGCATTATCGAGCGGCTAT
GGGGTTATTGTCATTTAGTCAAGTTATCTAAGTTTGAATGCTATTTCATTTCAACGCTGAAGCTCCTGTTGCTACAGCGGCCACCATGTTTGCTTTCACA
CTCACCCAGTCTTCCAACAGTGACTGCTCGCTTACAGCTGCACTTGGCCACTGAACA