Description :
From Genome Similarity Track
Location :
Scaffold_25:1548543- 1549683
Sequence
1140 bases(100 bases per row)
TTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTCAACGGACTATCCGGGTTCGGTAGCGCAAGGATCGGAGCCTGGAGGAGG
CTCTCCTTCACAGCCTCAAAGACTCCGTCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGT
AGTTCGCGCTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGACGAC
TTTGGCAGGATCTGCCCGTAAGTCACGCTTCCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAAG
TTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTTTTTACGTCAGACTTTCCGTGCTCAGCACGACTATGGACGAATATATCGT
CAAAGTACGTCTGAGCGTACGCCCGGTGGGGCCTAAACAACGGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATGACCAG
CCACTCCCAGAGTATACCGCTCGGAGTACTCATCGCTGTCAGCGGAATGTCGCTCGTTCTCATGAGCAATTGGTAGTAACCATCGACCAAGTCGAGCGCA
CTGTACAACGTACAGCCTACCATGTTGTTCTGCAGAACATCCTTGCGAGGAATCGGCGTTTGCTCCGGGATAGTGGCCACATTTAGCTTGTTAAAAGCAT
GAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGTGTCGAGTGCGAAGACTTACTCTCGCGCACCATCCCTGCCTCGTGCTTCGCACG
GAAGAATGCGTCAATGACGTCACACTGCTCTCTCAGCAAGGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCCCATGACACACG
CCTCGATCCGGAGGCAGGCCCGTCGGTGGGACTTTCGAGACAACGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCGAAGGATCTTTAAGGATCG
CCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGTCCTC