Description :
From Genome Similarity Track
Location :
Scaffold_885:15482- 17832
Sequence
2350 bases(100 bases per row)
CTCTCAAAGTACCGATCTTAGGGCGAGTAGTTGCACGCTCGAACGGAGAAACGGGACACAACCTCCAACTAACGACAATATTCGTAGCAGATATCCATTC
ACTCGTTTTGCTTGCGGTGATTCGGTTTTTTTCTTCGCGTCCACAAGCAAATCATAAAAATCCTGCGAGTTTGCTAACTTTCCGAGACGTACAAGTATAG
CAGCCCGACTCGAGCCAATTTGAGCCGCCCTTCTTACTGCTGTGTGGCGCTGGAGTTGATTAAACAGCATCGCGACAAGGGCTGTGCTTTTTTCAAACCT
TCCATCATAGTAACGCATCAAGTGTTTTATGAAGTTTGTAGGCCAGGTCCCGCTGGGCAGACACCCCCTCTCATAAAGAGACACGGAAACGCTGCGGCTA
TCATATCGCCGTTTTGAGACCACTCCGTTATAGGTTCTTCACCTCGATGGACAGTAACGAGAGGGGGCTTACCGATATCCTCAGTCTTCTTATCAAGCAT
CAATATCATCGCTTCAACGGCGGCATTCTTTACCGATAGATTCAAACCATCAGCATCCTTCAAAACTGTCGATTTTGAGATAATCGACACGCCGGTGCCA
TCATCCACGTATTCTTCGCCAAACCGCTCGGCCACTACGTCATCGTCGATTGATCGAGCTGTTACACTCTCACTAAACTCGACCCCAGCATAGATTTTTT
TTCTAAAATAGCTAAGGCGTTTCTCGTTCCGCCCGATTCATCAACACGAATGTAATTATCCACAAAGTACGCGGAAGGATCCGCATCCAAGCATACATGC
TATCGACGGGCAGCTAAAAAATTTGCTCGAACTTTTTCCTCTTAGCTTCCCACTCCCACGCGGACCCACAAACGTCACTCTTGGTATGCACTACTCCGAG
GTGCACGGCAACACCTTTGAGCATTCCGCAGGGCCGTCAGATGGGAAACAAATTGAATGACCAATGCTATGTTTTCCAGAAACAGCTATCTCCAGCTTGA
ACGATCTCACTGGAGCAATGCATTTGCTCGCAATGTCTCCTAATTCTGGCAGTTCTCCAGACCGCCCGTAGTCGTGCCCCGAGGCGATGCTAAACTCCGA
TTTGCGCGGATCCCTTGCACACTTCTTGCACAGCGGAATCGCAGCCAAATCCTGAACTAGCTCGGGATTCAAATGATAATATTTCCCCCCCCCGTGCACA
ATACTTGAAGGTTTTGCTCCACAGCCCAACCTGGTATCGAGCTAACATCATGCGCCTCGGATGTAGTCAACTCGAAGCCACTGTGCAGTTTATCAAAAGC
GACGAACTCCACAAAATCCTCAACAGTATTTAGAAATTCACAGCACGACGCGCAAGCCCAAAGGTCTCCAGAACTTGCCGAACTGCAACTAACACGACTG
ATGCAGGACTTGGCCACTTTTGCGTCAAGTGGTTCATCGAGAGCATTCAATAATCTTGCTTCTGTTGCCATGCTACCTGAAGACCCAACCTTCTCATCAG
CAAAAACGCACGCATCCAAatcggtggagcagcagtgAAAATAGAGTAGCACGAGCCGTGGATGCTTCGTGAAATTCCGTCGAAGTAAATCCATCCTCTT
CTCTGGCAACTGTTTAACTGACATCGCCTCTGCTACTAGCGTGTTCAAGGCTTCATTCCCTAACCGTTCATTCGTGTTCAGGGATTCATTGTCAACTCGC
TTATTTTTGGCGCGCTTCACTGTTGTCTTCTGTGAACTCACAGGGGTTTCGCGCAACCGTTTCAGAGCCTTATCGACGATTATATCCGCGCCTTCATTCT
GATCGGCTATTGCCGCGCTTTTTCTCCGAAGAGAGTCGGCAAAGCTGCGCCTCGCATCATCGTCGGCAAAGCACACCGCGGCATAGTGATTGCGAGCACC
GAGGGGAGCGTCTTCGCCAACACGACCCGCCGCGCAGTGATAAATGACAACAGGTTCTTCGACGACAGGGCCGTCAACCAAAGAAGTTAAATCTGCAGGA
GTAACCACATAAATTCCATCCGAGGACAATGTCACAACTCGTCGCTTTAGCatgctcgccatcgccataATTGGGATCACCCCCGAATACTCCAAATACT
GGTTTGGGCGAGCCACCAAGTCTCCTACATGCAGAGAATCGTGCCCAAACGCATCATACAGCTTTCTCCCTTGTAGAAAGCGCACCACCTCAACCCCAAC
TATAACTCTTAACTCAAATACGTGCTCCGAAGATGCCATCCCAAACGGTCGACGAACACCTGCGAACTCTGCCGCCGACCATACAGCATGGTAAAGGCAA
TTTCCATTGGCAGGCACATCTGCCCCAAAGACATCAACACAAACGTTGCT