Description :
From Genome Similarity Track
Location :
Scaffold_1470:1548- 5139
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1470-fgenesh-gene-0.2Nucleoredoxin
Pytir_DAOMBR486maker-pir_contig_1470-fgenesh-gene-0.350S ribosomal protein L22
Pytir_DAOMBR486maker-pir_contig_1470-fgenesh-gene-0.4Kinesin heavy chain

Sequence
3591 bases(100 bases per row)
CTTTCAAGTCACGAGGTACGTGTAGATCTCTTCAACGTCGCCCTCGGCATCCGCGATCACCTGCCGTCCGTCTTTCGTGATCACCTCGCCCTTGTAGTCG
ACAAACACGAGCGTCGGGATGCCAAATACCTGGAACTTCTCGCTCAGCAGGCTCTTCTGCTCACGGTTCGCGAACGGCAGCGCCACGAATGGCATCTCGC
CGTAGTACTCATCGAAGCTCGCGGCGTCCGAGTCTGACGACACGAACACGATCTCCACGTCCGGATGCTCCTCCTTGAGCTCTTCGTAGGTCGTGCTGAG
CACAGGCGTGAAGCCGCGGCATGGAGGGCACCAGTGTGCGCTGAAGTAGATGCCGACCACTTTCTTGTCTGCAAGTACTTTGGCAGTCGGCTGCACGCTG
TCCTTCGTGAGCAGTTCCTCGCCAAAAAGCGCCGTCCAGGTAGTCTCCATCTTGAATGATGGTTTAGTGATGAGGGTGCTTGTAGCTGGTGCTTCTTGCT
TGTGTGCTTGAGTGGAAATTGGAGAATGAGATAGCGAAGTAGAAGAGAGATGGCGCCTGTATTTTTTGGTCCTGTGTCACCAGCGACGGATGGATCTTGG
ATGCTCTCCAAACGGTCATCATTTTTAAAGTTTGTTGCTTCAAATGGGTTGAATGAGGTGGCAGAAATCAACGACCAATCTCATCAACCCATGGCGTCTC
GTGCCCCATCCATTCCATTTGTCTGAGCATATCTCTCGTGCGTGGGACTGATTTGCAGAAGGAGTTCTGGGTGCGCTTGGTCTGAGTGGAGAGTTTGGAT
ATGAGTGGGAGGAATGCTGGTCCACGCAGAATTCTTACCGTGACTGTAATGACGCAGAACGCCGTGGTGAGTCGTTTGCGTCTCATTTGTTCGGATATGC
CATGGCGCCAGCCAGACGGCTCCAGCGTCGACCGTGAGTGAGTAGCACACCAGCACGGAACGGCGGCAGTAGTAGCAAAGCATGCATGCAAGAAGGAGAT
CGTGGAGCAGAAAGAAAGCAAAAGTGAACAAAACAACACACTGGGGGGTTCGGAATAAAACTCACAAAAGAGATGTGTGTGCCGGGAGGCTCTATTCATC
GCGCTTGTCGGTCTTTTGCGCTACAGCGGTCTCTCTCGCGAGCTTCTTGGTCAAGAAGCGGTTCAATGGCTTCTTCGACGGGTCGAACTCGCGGAGCACC
ACGGTCAAGTGCGTGTGCGGGTGGTGCATGATACCAGAGCGGCCTGGTCAAAGACAAAGCAAGCAGGCACATCAGAATATCATCACGGAGTGAGTACAAC
AAACGATACCAATAACAACAGCAGCAATACTGCGGCGGGTTTGCCTCGCAGCACTACGCCTTGAACAAGAAACGCACCTCGGCCCATGATGCGCAGGCGC
TTCAGGAAGTGTCCTTTATTCACAAAGCACTCGGCGACCTGGAGGTTCTCCGGCTCGATCTGGTACTTGATGTCGGCCAAGTTGATCGCGTTCTGCACGG
TCTTCTGGATGATCGCGGCTTTTCTCTTCGGCGAGAACTTCATCTGCAGGATTGCCTCCTGCGCTGGGAGACCGCGGATCTGCTGCGCCAGGTACGTCAA
CTTGCGTGGGCTGCCGCGAATGTCCTTCTTCATGGTCTTCACGGTGCGCTCTTCCTCTGGCGCCGTGGCGTCCAGGAACGCCGAGGTCGCGTCGTCATCC
GTGCTGGTCTCCGAACCGACGGTCGTGGTGGAGAACTGCAGGAATGCGGCGGAGCAAGGGGTGGCGGTGGCCTTGGCCGTCAGGAAGGTGCCGCTCGAGG
CGCGCAGCGAGAGCGATCGGAACGCGGACAGCATCTCTCTCCTGCTCGCTCGTGAACGTGATGGAGCTCTTCGATTGTGGGCGAGCCGCTTGTTTTGCAC
ACAAGCAATGGTGGAGAAGCACAGGACCTCTATCTTTTCATGCTGTATCAATTCTCAGAGGCTTTCAGCAAAGATCCAAACAATTATCGACTCGTGTATG
TTATTTGTTGAAAAATCGCATTAAAAAAGCTCTTGAACATCATGAACAAACCTCCATGGTCACACTGACAGGCACTCATGTGAAAATGGTGCTGATGACA
ATGAAAATGATCATCATGCTGTGTCGTTTGGCTCTCTTTATATTCGTTCTCGCTCTCTCTCTCTTTCTCTCTCTGCACGCTCTATCGCTGGGTTGTGCGG
GAGGATATCTACACACACTATGTTTGCGGTCCTTGGACTCCTACTTACTACTTACTGACTACTGACTGGCTCACCACTTTGAATCAATCTCCTGCCTCTT
TGCATCGATTGGATCTCCACGTTTGCTGATGAAAACTCTATCATGATGCTGTGACGGAGCTACGCGAATGGAGACGTCGTCCGAGTCTTCTTGTCCGAGA
TCCAGATGCGCAGCTTCTCGATGTCTTCGTGCTCCGCGGCGCCCAATGCGTGGATGTCTTCAACGTCGACACTCGCGCGCTCCGAGTCGTCCGGCAGCCA
CTCGATGTTCACTTCAATGTCCGTGCGATTCGACACGAGCGGCATCAGGTTCGACACGAACCGTTGGCGCGACATCGGCGACAGGGACGGGATCTCAATG
CCTCGCACGGTGATCTTGCTCGCTGGCGTGCCGATCACGATGTCGGCGATCCAGCTGCCCATGTACTCAAACTTGTCTGGTCGCCCCTTGCAGATATCTC
GTCGCAGCGACATGAGGAACTCCTGCGTGAACCGCTTGCATTTCTTCTGCAGCTTGTCCTGTACAATCGCCTCGTTCAGCGCCTGCATCGACTCAGTGTT
CTCCAGCCCGTGCGTGCCATAGTCGTAGCACTCAGAGCATAAATTATAGTTGGCGCACACACTGCACGTCCACATCGCGCCGCAGATCGGATCCATGCCG
CAGCCGTCACAGAACGAGTTTGGATTCACGAACTTCTGCTTGCGCTTCAGCTTGGAGCCGATGATCGACGACCCAAAGCTCACACCAGAGCTGAATCGTC
CATACAGCGTTTTTGCGGGCTTTTTCTTCTTGGGCGACCCCGCAGGCTCGCTGTGTGTTCGCTGGAAGACCATGGAGCGCGGATGCGACGCGCCGCGGAT
GATCTCCAGCACTTCCGCCGCTGTCATGTGCGACTCGAGCTTGTGACCGTTTACGCTCAGCAGGATGTCGCCCTCGACCACTCCCGCCCGGAACGCAGGG
GTCTCCTGTTCCACCGTGGCGACCTTCACGACCAGCTCATTCGCCTGCGTGACTACAACGTCGGTCTTGAACCCCAGTGATGTCGACTCGGTGAACGACA
CGCTGTACGTGTCCGACGACTGATCCGCGCCAGACTGCGATCGAGACGAAGACGCACTGCGCGTGCTCATGCTTGCATTCGACGACGTGCGGCGCTGGCT
CTCGACCGACGCGAGCTCACTCACGAAGCGTGGCGGCTTGGCATGGATCTGCACGCGCCGGATACCGTGCAACTCGCGCGCTGATGCGTCATCGCCTTGA
ACACTCGGCCCGATGAACCGATGCGACGAGAAATCTTCAGAGCTCTCGCCGAAATCGTTCTCTCCAAAGCCGAGCGGTGTGCCCAAATCGG