Description :
From Genome Similarity Track
Location :
Scaffold_754:1548- 4666
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_754-fgenesh-gene-0.0Ubiquitin carboxyl-terminal hydrolase

Sequence
3118 bases(100 bases per row)
TGGGAGTACTCTGGCTGCGACTTGCTCGACAGCCACTGCAAGGAGCTCGCCCGCGCCGCCAAGCAGGCGCTCAAGGACGAAGAATAAGCTATTGTGTCTA
TTCCGAAATCCCCCCAGTGCCCTCCGGAGCCGAGCAGTGACAGCAGCAAGCAACAGCAGCAGGTTGTGTGAGCACTCGCCTGTGGCGGGGTTTCTGACTT
GTTGTTACTATCCAGCCCAGCAGCTCAGCTTCAGCCCTTCATGAGAAAATAAATGTCTGCATCGCCAGCATCTAAAGTGAAAAAGCACCCAAAAAACAAC
AGAAAATTATGGATTCACTCGGGCGTCAAACCTCCAACGAGGTCATCTCTTGTTCTTCAGCTTCTCATTATGCTGCGGATGGACACATACAATCTCATGG
AAACCAGACTATCCTTCTCACTGATTCATTGACATGCAAAGTGAATGAGCATTTGCGCCTCATGGTCATCACTTCACGTGCTCTCTGTTTATGTGGATAG
ATTATGGATGGATGTTATAGTATGGCTCACCTTAATTCACTCCATAATGCGTGAACAAGTCTGTCCATTTCAGTGTTTTCTAATGCCCACCACCTTAATT
TCCTCCTCAACTGAACAGCTTTAGTGTGACACACCTTACTTTCCGCTTGAGATTCGGGTTTGGGTTGGAAAGTGATGGATCATTCCTTCCATTCTTGTTT
GAGAGCCGATCCAAAACCCACACACAAAAGTAAGCGAGCCGCGTCGATAGATAGAGAAGAACGGACGACAAGCCCGAGAGAGAGAGAGAGAGAGAGAGAG
AACAACCCACAGAGACACAATAGATGACGGAGGTGACGGAGCAGCAAGCACAGCAGACCCCTGGCGGTGACGTGCGCGAGGCCGGTGAGGAGGTCTCGCG
CCACCGCCAGCAGCTGCACTCGGCGCTCTCGGCGCTGCCCAAGCCGCGCGAAGACAGCAGCAGCTATGAAGCCACCGCCGACCCGATCTACGAGGATGGC
TACGACAACAGCGGCTACGAATCCTACGTGGCACCGTACACGTCGTCGCCCGTAGTGTCGTCCTCCGCACCGATCTCCACGGCGCTGACGCTCTACTCGG
AAGAGGAGTCGGGGTACGAAGGGCCTGCGTACGCGCACTTGTTTGACTCACCCGGGGAGGAAGAAGAAGGCCCCGCGCCAAAGGCGTACACTTCCTACTC
GTCGTACTCGCCCGCAGCGTCGTATGCGCGCAAGCCCGTCGTGAAGAACCCGTACACAGGGCTGTCGAACCAAGGCGCGACGTGCTACATGAACAGCTTG
CTGCAGACGATGTTTATGACGCCGGAGTTCCGCAAGGGGCTCTACCAGTGGAAATTCGGCCGTACAAGCACCAGCAACAAGGAACGCGACGGCGATGATA
CCAACAATGCCAATAATGATGGTGATGATGAAGAGGAGTCCGAGGAAGACAACATCCCGTTCCAGCTGCAGAAGCTGTTTGCGAAGCTGCAGGTGAGCAC
GCACGAATCGATCAGCACGAAGGCGCTCACGAAGAGCTTTGGCTGGACGGGCGCGGACGTGTTCCAGCAGCACGACGTGCAGGAGCTCTGCCGCGTGCTC
TTTGACGCGATCGAGCGCTCGTTCAAAGGCACAGTGAACGAGACGCTCGTGAACGACCTCTACCAGGGCTCGCTCAAGGACTACGTGCAGTGCCACACGT
GCGGCTACGAGTCATCGCGGATCGACAACTTTCTGGACCTGTCACTTGTGATCCGCCCGTTTGGCTCGGAGGAGATGATGAAGAGCGTCGAAGAAGCCAT
TGAGCTCTTCTTGCGTCCGGAGTTGCTCAACAAGGACAACCAGTGGATGTGCGACAAGTGTAAGACCAAGCGCGACGCGATTAAAGGGCTCAAGTTCTCC
AAGCTCCCGTATTTATTGTCGCTGCAGCTCAAGCGCTTTGACTTTGATTATGCGACCATGAACCGCATCAAACTGCACAACAAGGTGACGTTCCCAAAGT
ACCTGGACATGAACTCGTACGTGAGCGACCACGCGTTGGGTACACGCGGTCGCGGCAAGATTGCGCGGAAAATGTCGATGGAGCGCCATGAACTCGAGGC
GTCGTCGCAGCACCAGCAGCAGCAGGATGGCGGCAGTACTGTGCGCGACCACCACATGCGCCGCCTGTCGTCCATGGACGAATCCCAGGCGCTTCAGTTC
AACGAGGAAGATGAAGAGAAAGGCGAAGACGATGATGAAGAGCAAGATGAGGATGGTGACCGCCACCAGCGACGAGACAGCACGAGTGTGCTGAACGAAG
TGGACACGTGGAGCGCCACGTTTGACCCGAAAGACATGGTCAAGCGCAACGGACCGCATGTGTACGAGCTCTACTCGGTGCTGATCCACTCGGGCAGCGC
GCTCGGCGGCCACTACTACGCGTACATCAAGTCGTTTGAGACGGGCAAGTGGTTCAACTTTAATGACTCGCACGTGAGCGAAATCTCGGACGACGAGTTG
AAAACCGCGTGGGGAGGCGGTGGTGGCGGCAGCAGCAGTTACGGCGGCCGCATGAGCTACAGCACGTGCGCGTATATGCTCATGTACCGCCTGGTGTCGG
AGGAGAAGAACGTGAATGAGATCTCGAAGGCGAGCATCCCCGAGTACCTCCAACAGAAGTTTCAAGCTGACGAAGAGCGCGCGCTCAAGGCGGAGCAAGA
GCGCCTGGAGATGGCAAAGAAAGTGATGGTGCGGTTCTTCATGAAAGGGAGCAAGCCAAAGAACGTGGAGAAGTCCATTCATTTGTACAAGACGAGCACG
ATTCGCGAAGCGCTGGTCGCTGGCTGTGAGGCGTTTGCCAAGGAGAAAGACATTGTGATCCCAACATCGATCGCGAACGTGCGGCTTCGCGGATACAATG
ACTACAACGCGATGCTCTCGGAGACTTTTGATGGGAAAGAGGACTCGACGCTCTCGTCGGTGGGCGTGTACACGGGCCAGCAGCTCTTTATCGAAGTGAA
GAGCGAGAGCGAGCAGTGGGAAGCGTACGATCCGTTCAAGTTGCAGCTCTTTGTGCGTCGCTTTGTCGATACTGACGCCTCGGATGATGATGATGGTGCT
GAAAACGCTGGGAAAAGC