Description :
From Genome Similarity Track
Location :
Scaffold_2006:1548- 3267
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_2006-abinit-gene-0.3ATP-binding Cassette (ABC) Superfamily

Sequence
1719 bases(100 bases per row)
CCGTGCACGCTCAGCTGGGCCAACCTCACGTACACGGTCAACGTGGCCAAGAGCGAGCAGAAGACGATCCTGAGCAACGTCTCTGGCCGCTGCGCTCCCG
GAGAACTCACGGCCATCATGGGACCCTCGGGCTCCGGCAAGACCACGCTGCTCGACATTCTTGCTGACCGTATTAGCTCCGGTCAAGTCGATGGCGCCAT
CGAGCTCAATGGTGTGCCACGCAACGTGAAGACATTCCGAGCCGTGTCGAGCTACGTGGCCCAAGAAGACTCGCTCTTGGGTTCGTTCACCGTTCTTGAG
ACGCTGCAGATGGCAGCAAAGCTCACACTTCCTAGCAGCATTACGAACGAGATTATCAACGAGCGCGTGCAGCATGTGATTGACGAGATGGGACTCCGCG
TGTGCGAAGATGCACCCATCGGAGATATTTTCCGGAAGGGTATCTCTGGTGGCCAGAAGCGTCGTCTGAGTATCGCGATCGAGCTGCTCTCAGAGCCATC
GATCTTGCTTTTGGATGAACCCACGTCTGGTCTCGACTCGTCGTCAACATACCACGTTATGAACCTGATCGTACAGCTCTGTAAGGAAGGCAAGACTGTG
ATCTGCACGATCCACCAACCGTCGTCCATGGTCTGGGATATGTTCACCAACATCGGGATTCTCACTGCAGGCGAAACTGTGTACTTTGGTCCGCGCACAG
AGATCATCAATCACTTCAGCGCTGCAGGATACGCGTGTCCGATGTACTCGAACCCAGCCGAGTACTTTATCAGTCTCGTCAACTCGGACTTTGAAGGTCA
CGCGGACATTGACAAACTCGTGCAGAAGTACGCCAAGAGCTCGGTGGCGACGACCGTTATGCGATTGATCGCCGACGACCGCAGCCTTGCGCACGAAGCT
GACCCGGTGGAACCCGTGCTGCCGTCTGCGTTGCGCCAGTTCGGCGTGCTCATGTACCGCAACTCGCTCAACAACATCCGCAACCCGGGGATCTACTGGG
TGCGTCTGTTCATGTACTTCATGCTCTCATTCATGGTGGGCACGATGTACCTGTCGACGAACAACAAGATCTCAGACGAGGACCTGGTGCCGCTGCTGTT
CTACGTGCAGGCGTTCCTGGTGTTCATGTCGGTGGCCGTGCTGCCGTTCTTCATTGAGCAGCGCGCGGTGTTCATGCGCGAGCGCGCCAATAGCTCGTTG
AACGTGTTCAGCTACGTGGTGGCGAACTTTCTGGCGTCGCTGCCGGGCGTGTTCCTCATCGCGCTCATGTCGTCGCTGCTCGTTGTGTACCTCGCGGGTC
TGAACTCGTTCGGGTACTTTTTGCTGAATCTGTTCTTGTCGCTGGTGGTGGCGGAGTCGCTGATGCACGTCATCGGCGCCGCGGTGCCGCACTACATCAT
CGGCATCGCGCTCGGCGCGGGCATCTTCGGTATGTTTATGCTGTGTGAGGGCTTCATGGTGCCGCGCGACGCGATTCCGGACTACTGGATCTGGGGGTAC
TACCTCGCGTTCCACACGTACTCGTTCGAGTCGTTTGTGTACAAGCACTTCAGCGAGGAGACGTCGCCCGCGGCCACTCAGATCCTGCAGCGTCTGGGCA
TGGAGAACGTGGACGTGAACCGCGACATGGGCATTCTGATCGTCTACATCGTCGTCTTTGAACTCATGTTCACGTTCATCCTGTATAAATTCCACACAGG
ACGTCGGTAAAGGTTGCAT