Description :
From Genome Similarity Track
Location :
Scaffold_83:15478- 17374
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_83-fgenesh-gene-0.96,7-dimethyl-8-ribityllumazine synthase
Pytul_var.sporangiiferummaker-pug3_contig_83-snap-gene-0.12Vacuolar protein-sorting-associated protein

Sequence
1896 bases(100 bases per row)
CACGGCCTCACTTTCGTAGTCAAACTTGCCGGCGTTCTCGTCGCGGATGATGCATCCGAGGCAGATGATGCCGTCAAGACTGTCGTCACTTCTCATCATC
GCTTTCGCCGCGTAGGGCAGATCAAACGGCCGCTGGACGGTGCAACATCTCAGATCTTGGCGCGCGACGCCCTTGGCGAGCAGTGACTCCTTCGTGCCAG
TGACTAGCGGCTCTACGACGTCGGCGTGCGCGCGGGCGGACACGATCCCGAATTTGAGGCCGCGACCGTCCTCCTCGATGAAGCCGATGCGTCGGATCTC
TTCTGTGGTCATCGTGGACGAGTGAATCCAAATGCGATTGTGCGGTGAGGTCGCTTGGCGTTCTCGGAAGTGCACATGCTCCCGTTGAAGAACGAGACGC
CGAGTGTGGGTGGGTGAGTGAGTACTTTTCTTTTCCAACGGTGTGAACTTCAACAGCGGCATCCATTATTTCATTTTAACCGGTAAAGATAATGCTTTGT
TTTAAGCCGTATAATAAAAGGTTATTGTGTATTGCATTGCTTTGTACAATGTAAGAATTGTGCATATTGTGCATTGCATTGTGGGCAAAGCAAACACTTC
ATACAGACAAGTATCGCAAACATTGCATTGTTGTTTGGACACACGACAACAACAGCAAGCGTGCAAGCAACATGGCCACCGTCGACAAGTTCGCGTACCC
CGAGTACTACGACTTTCCCCCGTTCTTCACGTGCGGAATGCTCTTTGTATATGCGCCACTCGTGCCTATACGCCATCCCTGCCTAACGCGCATTCTCTCG
CTCATATAAACAGCCTGCAGCCCGTGCGCGCGACGCGCGAGAAGCAGCTCGTGCTCTGGAAGCAGCTCATCCTCGAGTACCACCGCACGCACGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCGCGCTCTTCGAGAACGTCAAGATCTCGCGTACGATATGTATATATGTTGTCGAAAACTGGACGCTCCTA
ATGCATGCCTCTATGCTGTTTGTATACATGCATGTGCACAGGCAAGATGGCGCAGGAAGGCCGGCTGGCCGTGGTCGAGTATCTCATCCGCTGCGGCAAC
GGCTCGTGGGAGGACGACACGCGCACACGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGGGCCGCCGAGATCTACGACTTTGTAT
GATGCGTGTGTATATTCCTTATGTCGCACGTGAAAGTATAAGCTCATATTGTGTGTATGATAGGCCAAGCAGCGCGCGATGATCGGCAACGTGTTTACGG
TCTACGAGCTGTACGCAGGCGAGGAAACCCTCGGCTCCAGTGCGTATTTGTGTTTCTATGCAAGTTGTGTGCTTATATAAGCAAATATGGCAGCTGACAC
GGTTGTGTATATGTGGGGAAAAGGTCTGCACGGCATGGAGCCGTGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTGCGTCTGTGTCGACAACAATGTGCATCGTTGCAACAGTATCATGCTGACAATGCTTGTTTATGCTGTTATATTATGCAAA
TGCATGCATATAGGCGGCGATCATCGCCGGNNNNNNNNNNTGCGAAGAAGATGGCGTCAAGTTCCTAGGCACCGACTAAACAATGCGACGTTTTTTGTGT
ATATTTGATTTCGTGTATATAGATATATATATTGTGGTTTTGTATGCATACTGGCTGTGGCTCTGTACGTGAATCCGCAAGCGCATGTCGCTGTTTCCGG
GACCAGACGCACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCGTTATGAGGTCAACTGCCACGAAATGGCTCTGTA