Description :
From Genome Similarity Track
Location :
Scaffold_29:15477- 19324
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_29-snap-gene-0.19Sodium/hydrogen exchanger
Pytir_DAOMBR486maker-pir_contig_29-snap-gene-0.20Conserved gene of unknown function

Sequence
3847 bases(100 bases per row)
ACACGATGGAGGATGCCGTGCTGGTGCTCGCGATGCTCTTCGTGCTGGTCATGTCGTCGTTCATGCTCGACCGCTATGCATGCATGATCATCTCGCAGTC
GGGCTTCGCGCTCGTGTTCGGGCTCGTCGTGGGGCTGCTGCTGCTCGTCACAGGCAAGCGCGAGTCGCTGAGCCACCACCTGAACCTGGACAACACGCTC
TTCTTCGACGTGCTGCTGCCGCCGATCATCTACGAAGGAGGCTTCTCGATCAAGCGCCAGGCGTTCTTCCGCAACTTCCCCGCGATCATGAGCACCGCCG
TGCTGGGCACGGTCATCGCCACATGCATCACAGGCGGCGTGCTCTATTTCGCGGGACAGATTGGCGCGGTCACAGCGCTCTCGTGGGTCGAAGCGTTCCT
CTTTGGCGCGCTCATCAGCGCGGTCGACCCGGTCGCGACGCTTGCGTGCTTTAACAAGCTCAACGCGCCACCGCTGCTCTTCAACCTGGTCTTCGGCGAA
AGCGTGCTGAACGATGCCGTCGCGATCGCGCTCTACCAGACGCTGCTCAAGTGGAAGCCCAATATTGACCTGAACGCGCACGAGCTGCTGCTGGTCGCTG
CAAACACCGGCGGCATGTTCGTGGGCTCGCTCCTGGTGAGTTCGATGATCACGCTGCTCGGTGCGTTCCTGCTCAAGCGCAAGATGTTCGCGACGTTGCG
CCACTTCCCGACCTACGAGATCTCGCTCTGCCTGATCTTCAGCTTGCTGACGTACTTTGTCGCTGACAGCTTAAACCTGAGCGGCATCGTGTCGCTGTTC
TTCTCCGGCACGATGACGGCGCACTACCACTTCCACACGATCTCGAAAGCCGCGCAGCACTCGTTCACGCACTTGCTGCACACCACGGCGTTCATCTGCG
AGAACATTGTGTATGTGTTCATGGGCACATCGGTGATCATGCTCTTTGCGGGCCACGTCGACAAGGACGCTGGCACGGCGCTTCGCGTGGACGACATCGA
CTGGAAGTTCATTGCGCTCACGCTTGCGGCATGCCTAGTGGCTCGGTTCTTCAACATTTTCCCGCTGCTCGGGCTCTCGAACTGCTTCCGCTCGACCTCG
GAGAAGATCTCAACCAAGTACATGACCGCGATCTGGTTCGCGGGTCTGCGTGGCTCAATCGCGTTCGCGCTTGCGAAGAACTGGTCGTACATTGGTCTCA
AAGGCGCGTCGCACCGGAAGTTGATCGAGTCGACGACGCTGATGGTGGTGCTGTTCACGACGATCGTCGTCGGCGGTCTCACGGGTCCATTCCTGTCAAT
CCTGGGCTTGGTGAACAAGGATAAGAAGGACGATGTGCGCGCGCAGCTTGAATCCGACACAGGGTCGTCCACGGATGGCACGGTGTCCCCAGCGGCTCCT
CGACTCCAGACGCGTCATGTGCCGCGCCGATCGATGCATTATATCGTCAGTCAGGGCAATGGCGAGAACCAGACTCCGTTTGTCGAAGTGCCTACATCAG
AGAGCACGGTGACGACGATGGATATGCTCCGCCCCGAGGTCGTCTTGACGCCGCGTCCTCAGATGCTCGACAGTTCGAGCGATAGTGAGGACGACGATAG
ATGGGGCGAGTCTCGCACGACGACCCAGCCGCCTGCGATCCAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGCAGAGAGTCGATCACAGGCGCGT
TCTTCCGCTCGTGGCAGGCGTTTGACGCATCGCGCATGCAGCCGATCTTCGGTGGCGCGCACTCGCAGGCGCAAGAGTCGCGAGCGTCCATGGTGGCATT
GCCGCACCTGCAGCAGTCAAGTGCGAATGACGATCCCCAGAGCATCACGCTGCGAGAGATCACCAAGATCCGAAAAGAGAACCTAGTGTGAGCTAATTAA
CCGAGCGAGCGAGTAGCAAAGTTGACGAAGAGGTCTAGTTGCTGGCAGCTCCGCGTTTTCCCTGTTGGCTGACTCCTTTCTCTTCGTACTTTTGCAGCAA
AGCGTCAAGAGCCTCTATCTATATGCCCTCTTTATCAAACAGGACTTCATCATGTTTCCATATTCCTCATCCTCTACACGCACGCCTTTGATAACTAACT
CTACATAGTGTCAAGAGGCTTCTTCTCATCAGTTCTCCATTCCATTCAGCAAGTGCAGCATTTTGTGTGGCCAGTTGTTATGCAGTTTCTTTTCAACTGA
CGATCGCTTTAGAGAGGGTCTGCTCCGCACTGTACCGCGCTGCTGCTGCTGAGAAGCAATTAGAGAACGTGACGTCAAATGCGCACACCGTCGACGACGA
GCGAGCAACGACGCGAAGTGAACAAACAGGGCGGACGATAGAGACGACAAGCATGACACGCCATGAGAGCGACGCGCACGCGCAGAATGGCGAGGTCGAC
GACGACGATGTGCAGCAGCAGCAGCGACTGAAGAGAGTCGACGGCGAAGAAGAGGAAGGAAGTGGCAACGACAACCAAAGGGAAGGCGAGGAAGATGAAG
AGGAGGACCTCTCGTTCATGCCGCCGGTCGAAGAGCTGGAGAACCTGATCCTGGAGGCGTACAACAACATGCAGAGCGACGGCGAATTCATTTTCCTGCC
GGATGAGGTCGCGCAGAGGCTACATCAGGTGGCACAGATGGTGCGTGATGCAAATAGCAAATAGGGAGGGAATGGGGCTGTGCGGCCGCTTTGCGTTATT
CTCTCTTTGTGTCTTTGCTCGCTCGATGGTAGAGTGTGCCGTAGCTAACGCTATAGTTCTTGGATAACTCATAGATGCAAGAGGCAAATGCGGGCTTGGA
GGACGATGGAGACAACCAGCAGAACCAGTCGGATGCAGAAGACGCTGGTGACGCCATCAGCGATGACGAGACGGGGGCGTCCCAATCCACCGAGTCTCTG
CAGGAAAACGATCTACAGGAGCCCGAAGAGGAAGACGAAGAGAGACAGGAGAGAGAGCAGGAACAAGCGACTCGACCACCAGTGAAAGCACCGAAGCAGC
CGTTTGAGTCCAAGTTCATGGAGCTTCCGCCTGTGCTCGAGATTGACGAAGAGGTATAATTGTTCACATCTCTGCTCACAAGAGTCATCTTACTAGAATG
TGGTACACTCTTATCTTATGCATATGGCTATAGGGCTCAAGCGACTCGCACGCTGGCAGTCCGGCAACAGAACGGGAGATCATGAACGCCTCCCCACCGC
CTCCTCCGAGTAGCGGCAGTCGAAGAAAGACCTCCTCCATTCCTCCGCCGCCACCATCACACGCGCCAGTCCCTGCGAGTCCAATGAAAACCAGTGCGAA
GAGCGCATCATCACCATCTGCCCCCAGTAGACTTAGAGCCCCACGTGTCGACACCAAGGTTGCTTCGTATGAATCAAGAAGAGAAGCCGCGCAGAAGCTG
AGAGAGGACAAGGCCCTTCGTGAGCAGCGTGCGCGCGACTCGGCGAAGAAACAGCGCGAGGACGCGCGACGCAAACTGGAAGAGGCGCACCAGCGGCAGC
TGGAGGAGAAGCGGGAGCGCGTGCGGCGGATGAGGACGCAGCGAGAAGGCGTGAAGCCCGTCGCAAGCAGAAAATCTCCTTCTAGTACAGGGAGTACTGG
CAAGTAAATAATAGGAAGTTTTGTTTTTGTGAGTGGTATATGATGGCGAGACAGCAAGAAGAGTACATGTGAAATGCTAATTGGCGTCTTTCCTGTTTAG
CTTCGCGTTATCCAGGCACCACAAGTTTGGCGTTTTGGCTCACAGGTCTTGCGCCAAGAGTTCGAGGCAATTGGGATCCACTTGCTGCAGCAGCAGCCGC
ATGCCGTCGAGTGCGCTGTCGAGAACCTGCAGTTCGCGGCGTAAATT