Description :
From Genome Similarity Track
Location :
Scaffold_281:15473- 19085
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_281-fgenesh-gene-0.3Guanine nucleotide exchange factor
Pytiw_DAOMBR242034maker-piw_contig_281-snap-gene-0.12Bromodomain containing protein

Sequence
3612 bases(100 bases per row)
AGCACCATGCAGCAGCATAGCTACTTGTCGTCACCGTTGGAGCTCGTCGCCTGGATTTCAAGGCACACAACGAGCGAGAGCTTAGTTGCGAATGAGCCGA
CAGCAATGACGAGAGCACTGCTGACACAGCTCTGCAGGAGTGACAAGCAACTTGGGGCGCACCTTTTCAGCGTTTTGTACGCGCTGCAGCAGCTTCTGGA
CGTTGCACTCCTGCCACGAACACAGAGAGAAGCGATTGAACTGCTGGCGCAGGCCATTGCACACGTGCAGACGGCGACAACGCAGCAAAGTTGAGATCAA
CATCGCCAGCAGCTAAGTCTCCAGAGGAGCCCGAAACCAGACAGGCTTAGGAACAACTTCATGGTGCACTTTCCAGCGCCGAGGTGCGCGATGATACCAG
TAAAAAAATACGCGCCACCACCACACATACTCGAATACCTAGCAGCCCACCATCGCCAGCCAGGCGAGGGCCAGAGTACACAGCGCTTACCAGTTCGATC
CAAAAGAGGTCTGGGAGAATATCTCATGGTGCTGAGCATTAATAAGAGAATGAAATACGAAAAGAGACGAATTGTTTCACGCACCGCACACCAAAACTCT
TCCTCGTACTGCCTGGCTGTCGCCCTCCACGCCACACGTTGCTCCACTGATCTGCCTCAAATCTGCGCCCGCGTTCGATCTGTTTTTCTTGCTTGTTGCT
GAATCCGTTTAAATAGCTTGACGCGGATCTGTTTCTGGTTCCTGGGAGGTCTTCATTCAATGCTCGTCTTGCTCTTCTTGGCCGACGAGCCGCCGCTGCT
AGCGGACGCAGCAGCAGCCGAGTCCTTGGACGAACGCTTCGACGACGACGAAGACTTGCGTGAGGAGGACGACTTCGGCGTCGACAACGGCTCGCGGCTG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGACGCGGTCAAGTACGAAT
TTCTCCAATTCTCGGAACGTCTTGTTGTCGATCGAGTCGATCACAATGTCCAGCTCATCCGGCGAGCTCTAGAATACATAAAGGAAGACAATTTGTGAGT
CAACCGTGTTTCAAAACGAGGCACAATGCAATATTAAGAACAACGTACTCTGTCGAGCGCCTTGGGGCATTTCTCCTCGAGAACCGAGACGACCGCACCG
AGGTCCTTGCTCGAGACCTTGTAGATGTTCTGGCTAAAGTAGATCTTCTCGTCCACCGACGGCGCTCTAAATCCAACAAAAGCAAAACCAGTTTTCACAT
ATTAAGCATGGACCTCAGCATAGGCCAACACCACCGCGCGTACGTACGGGATGCTTTTGTCGGCGCGCGGGGCGGCCCCGACGTCCAGTTTCATGGTCTT
CACGCGGTCCTCAAAGCGCTTCGAGAGGCCGTCCGCAATGTCGTAGAGCTCCGACCCGTCCTAATAAAAACACAAGATGTAACATGCGATTAGTTGGACA
TTTCGCATACAATGTGTAGGTCGACATTCTAATTCTCCTTCTTACCTGGTTGTAGAGCTTGCAGTTGTCCCAGACGAGGCGCACGTCGCGCGCGAACTCG
GCCGCCTTCTTGTACTCGTTCTTCGCGAGCTTGTTGCGGATCGTGCCCAGGTCCATGGGCACCTTCACGACCTGGAGGTAGTCGTAGAGCCCCCACTCTT
CCCAGTTCACACGCTCTCGGAACGGTTCTACGCGTCAATAATTAAACCCCAACGATCAGACACTTTCACAGCGAGCCAGCCAGCCATGAGCACGCGCAAC
AGCAATAGCGATTCGAACGCACCCGCGCTGTCGAGGCGGATGAAATACTCGAGCAGCTCGCTGCATTTCTTCTTCTGCTCAGCGTCCATGGCGGTCGCAA
TCTTTCCTTCTATGCTGGTGTTTGTGGCGTTACTATGAACAAAAGAAACAATGACATAAGACAAAGGGTTAGTACACAGCGCACGTCATACATATATAGT
ATCGTAAAGAGCTGCCCACGCGTGTCCACCACACGCTCAAATGCACTGCGTTGCAGCAAAACAAGCGTGGCCAGCCACACAAGTCACAGCACGCAGCGCA
CACCAGCCAGTGGAACGAGTGTGGCGGTGTCTCCACGTACGAACACGTGTACTGTAGGCGCATGGTGCACTCGTACACACATACAGAGAGATAGAGAGAC
GCACATACCTCGTAAACCCCCGCCTCTTTCTTGCTTTGCTTTCTTACCACTGTTGTTGAGAGAGTGGTTTCTATCAGCAGGTATAGTTACTAACGGCATG
TTTCCCGATATTGGAACATTATCAATATATCAGTTAAAGTGCCAAAGTAACTAGAAGTAATACTGTCATATCTCTATATAACGTATTTCACCGAATATGG
CACAAGAAAGGTTATCGCGTTGGAAAATGGGTCGTTCCTAAAACATCAAATCGCAATTTGGTTCTGCTCAAACGTGCATAAAAAGTCATCCCTGGCAGTC
CAGTGAGTACTATTTGACCGAGCCTTCAGAACATGCGAAGCAAGTGATCCAGCAGGACCTTTTTGCAGTTTTCATTCAAAAATGTAGTTTACCAGGCCAT
GAGGCGTCTCAAGCGTCTCCTGGACATCGCAAAGCAACCGGCGCAAGACAAGGAGGTGAGAGCTCGTGCTCGTGATCGCATATCTCTATCAAAAAAAATT
CGTATGTGTTTGTTCTGGTAGACTCACGAGAGGCAGGCGCTGTTCGTTGGCATTGTACATATCATTATGAAATCGCAGGCTCTTGGTGCTCGCGACAACC
ATGACCATGTAGATGAGCTTCAATCCCAAGATGACCCAGATGCTGACAGCAGCACAGGAAGTGCACGCCAGATTTCATCAAGAGCTATTGGCAAATAAAC
AACGTGCGAGCGACCAGCAACGTCGCGGATCTGGATTTCTGAGCGAGAGACGCTCTCACTGCTGCGGCTGCTGGACACGTACAAACCCCTGGCTCGAGAA
GAATGGGAACACGTCATCAAGCTGCAAAACGAGGCCTACCCAGGCGACGAGCGCACCAGCGATTCTCTCAAAAGGAAATTCGCCAAGCTGTATCGCCAAC
GAATTCCCACTGGAGACCCCCTCATACCCAAAGTTGTGAAGTTCGCTAAAGCCATTCGCAACGATATGACCCAGCGTGCTGACATTAGTGATGGCGAAGA
TGCGGCCACAGAAGCGGCGCGAGCTTTCAGCAGCCCGTCGCCTTTGGCGGACACTCTTGACATGCTGTTTACACTGCCGAGCACGCCACTTCCAGCTGGC
TACAGCCCTCGCCCGCTCGTCGGCAAACGTGTTGTACCTGCACGATCGGATGGGGTAGACGAGGACGACGCGTTTCTGGCAACGCTAAAGGTGTCGATGC
AGCAGGAGCAGGCACGAGCTGAGCAAGCCCGAGTGCAGCACGATATTGACCAAAAAGCCATGCTGGTGCGATGGGAACTGAAGCGCAACGAACAGCGCGA
ACGTCGAGAGGA