Description :
From Genome Similarity Track
Location :
Scaffold_283:15472- 18722
Transcript NameFunction/comments
Phypl_g6424conserved hypothetical protein
Phypl_g6425conserved hypothetical protein

Sequence
3250 bases(100 bases per row)
CCGTCGTCATCGGAGGCTCGATCGTTGTGTGGAAGCTAGCGTCACTGACGAACGATTGTTCGCGACTTCGTCGGTCTTCTCTCCTCCTCTCCTCAGGTGG
CGTGAACTGGTTGCTAAAAGACCGGCTGAGTctgttgcgctcgctgctaCTCCCACTGCGACTCAACCTGGTCTCCCTTGCGCTCATACTCAAGCTCCTG
TTCTCACTGCGACTGGATCCGTACTCTTGCGAGCTCATACTGGCGCTGCTCATACTGCGCGAGAACATTTCGTTATCCTGCGTGACCTCCGAAGGCAGAG
GGGGACGGACCccgggcgtcgtcgccgcgaAGCGACAGACCATCTTGTTCTCCGTGATGGAGTCCTTCGGCACCTTCTTCCAGAACGcacgcagcgacga
gctggagtcCGGGTCCAGCGGCTCCGCGGCCTGCACTTCATCCTCCCGCTCCACGCTCTGCACCAGGAAGAGTTCAGACGATTGGCGGGTCATCAGGTCC
CGCTGGTCCATGGCGCCCAGGCGCTCGCAGGTCCTCGCGGTGGTCGTCACAGTCACTTGGGCACTGGCTCCGGGCGCCACGAGCCCGTGGGTCGGACGCA
CCGTGAACGCGTCCGGGTTGCGCGTCCGCACACGGAACACCACGTCATTGAGCGGCGACAGGTTGGTGAGCgtgaggcagcagcgcggccgctGCTCCGA
GGCCACGCCCGGCAGTgggaacagcagctcgcgcgccggctccagcagcagactcgaGTCCACGCCCACGGACGCGGTGATCATCCTCGCCCTATAACGC
CAGAAGTGCGCTATGCAATGGACTCGTTCTCTCTCTCGAACACGATTGAGATTGTGAACTTGCAACACAACGCTCGTCGCGATGGCACGTCACTGACGTT
CATGAAAAAAAGGCATACAAATATTAAGTCTATTTTAATCGTACGTTTAAGTACGATTGCCAGTGTGTCGCATAAGACTCGATGTAGATCTTGAAGAGGC
GGCATCCATCGTTGTCACTGCCAATGCGCGCCACTTGCCACCGCGCGAGCGTGCAGCGGCGCTACTGCAGCGgcgtgctgtcgctctcgcatatggcggc
gttggcgctgTGGGCGGGCGCGGCCTttctgccgctgctgctggcgctgggaTCGCGAGGTGCGTGCGCAAAAATGCTGGCAAAATTCACGGGGGATGGT
AACGCTTGGTAGATTTCGTGTTGCGCGCGAGCTCCTATAGAGAGCAGCCCGTGGTTGGGGTCACGGACCAAGTGCTCTGCGTTTTAGAAGGCGAACGGGA
CCGGCAGCCGCTGACGCTCGTGCACACGACGTTCCCGGAGCGGGTCCGGCAGCTCTACGCCAATGACAGTCTGCGGACTGCTTCCGTCAAGGTATGCACG
AAGCCCTATTACGTTCGTTGGCGGTGCTGTATTGAGCGCTTTGCTGCGGTGGCGCAGACTTCTGGTACGGACGTCAATATGGACGGCATCGCTGAGTCGG
TGCACCTGGAAATTgccacgccgctgtcgaCTAATGAGATCATTCGACAGGCCACGGTGGCAGTTGTGCTCGATTACACACTGAAGGTGCACTTGCCGCG
GTTACGTTGGACGGGCTCAGTTAGCGTGCTGTAACACTGAGCTggttgtgtgtgtgtgtgtgtgtgttttttttttctcggCGAGTAGAGCTACGCCAAG
CTCAACATGGACGTGCTAGCGCTGTGCAGGCATTCGTCTCCGTTTGGTGGAGACATGTTGCATGCAGACGGCGACCTTGACTTGCATCAGCGCAGTGCAC
TCGACATTACAGATAGGTACGTGTGTGCTATTATACGACTCGTACGACTGGATCGACGGTCTCTAATGATGCGGTTAATTCGATCGCAGCATGCAACATC
CGTACATCGCTTCACCTATCGTGAACATGACCAATGCCAACACAACCCAGGAGCTACTGCTGCAGTCCCTCCTTAGCGGGTACCGAGAGCGCAACCGTAA
GCTTCTGCCTTTGTGCGTGCGATAATAGTCCAGAACTGACAAGGTCTGTGCATGGTGCTGAAGATACCGCCAATTTTCACGCCCCGTACCCGATTTATAC
GCCAAACGGCAACTCGTCAGAAGACATCCGAGTGTTCCGGGTGATCATCGATATACGGGTAGACGCCGTCAACGTCCTGTACGTCTGTATATGGTGCTCT
GCCCATCTTTGTCGAGATATTCACATCAATCTGGCCCGTGCAGATACACCCCAGAGTGGCCAGAGATCGCGAAGCATGCTTGGATACAGGTGGGCTTGCA
GCACAGCCTCGATACCCAACGCTCGCTCATACCCTTGTCTGTATGTGAACCCTCTCTCCGTCAGTACTACTGCATCTTCGTGGTCGTGTCAACTCTCGCC
ATTGCTCTTCGCGAGTATCTCTTCACTAACAAGGTTCGTTGCCGCCCGTCATTGGCAATGACTCATTGCTCCTTGTCGCTCCCGGTGCTCTGCTCACACC
TTGCTCGATTCCCATTCAAACCGCAGCTCCTCcccagcgtctgcgtcgtcgacgagcccCGACTGAAGCTCGCCGCCAAGTACGAGTAGCCCGTTGCCAA
GCCCAATAGCGAAGATACCAAGGGGACTTTGACACCAGAGATTGACTTCAACCTACAGCTGCACCAATGTCTCACTACGAACGTGTTTTACTCACTGCTC
CCTTGATCAACTGTAAGCGACTTGATGTCAGGTTAGTTGTCTTGTTTCGTAAAATTGGTTTAGGTATACGTTGAATATTGTGTATACCTAGCTTCTGCGC
GCGATCGACTTGGAAGGGTTTCTAAGCCGCATCAACTTTTCTCATCAAATccgcagcatgagcagcaagGACGCGAGCGAGCCCAagacgcaggaggagg
aggatctGGACGACCTCCTCGAAGGTAGACGCCCGCATCTCCGCCACCCACGCACCTGCCCACGCGCTCACCTTCTCTCCGCGCTGTTGCAGATGCGCTG
GACGACTTCGCGGACGAGGTGAGCGCCGCGCAGGCCTCGGAGACCTCGAGCGTGGTGCAggaagccgccgccactgccgccgcgACGCAGGACAGCGAAg
acaacaagctgcaggaggtcgGAGCAGCTGCTCCGAGTCTGGAGGTGacaggagtgatggtctgACGCTTGTGGTTAATGCCAGAACATGGCCAAGTTCC
TCGAGGACGCGCAGAATCCCGAGTTccagaaggtgctggagcaggccTTT