Description :
From Genome Similarity Track
Location :
Scaffold_206:1547- 6007
Sequence
4460 bases(100 bases per row)
CTCAGCAGTATGTACGCTCTGAGAGCTAGTACCGATGTGGCCGATGTGCGTCTCGAAAGCAAGCTTCAGTATGATTATGCCAAGCTTAAGGCCAGAGGCC
AATTGCGCAATCGCACGCGCTATGCTTCCTCTACTACGATAGCCGCGAGTGCTGATCAGACTGTGACCACTAACCCTCCAACCCACACCACTAGTGGTGG
GAAACGGCCTCGGTCCCGAGATGGCCCTGGCCACGATGTTCAAAAACATCTAAGGCGTATGGGCAATCTTGCCGAAGGAGTATCTCGTACTCCCATGAGT
TTTCCAACTCAGGGTACTCTCGCCACTTTACTAGATACTGGTATTGGCCATGACGACGACGTCGTTTCAGTAGTCTCTTGACATAAAACTGGTGATTCCC
ATGCTTATCGAGCAGTGTCGGGGGTGGCCGGTGTACCGGTGGCGGACCACGAGAAATTGGTTCTCGAAGTGAAGGGTCTCCAAGAGACCTTGGGTAAGAC
CCAGCGCATGCTGGATGCGATGAATAGCCGCCTTCAGGCGATGGAGCGTGCTCAAACTCGGAGCGAGGCTCAGTTGGACTTGCTGATTCGCTTACAGCAA
TCCGGGGCACAGCCCTCGTTGTTGGCACATGCGCCTCCAAGTTCACATGGGAAGGATCCCGGTATGGCTTAAGCAAGCCTACGTAGAACACTGGGTGTGT
GCGCAATTTGCGCGGAGGGTTGAGCGTATACGAAAGTCCCTTCTTAGCAACGACCGTGAATGGTCCAATGAAGCGCGGACGCAACTTTGTCTTGAAGACA
GCGGACACTACATTTGTAGGTAAGTTTTTAGCATTGAGTAATACTTGGTCTCCGACCCGATAACGTTCAATACAATCTCTGTTTTTAGCATCTGCTTGTT
GTTTTTGTTGGTCTTGGCTTTCAGCCATTGCGTCACGCACATGTCTTAAGACATTCAATCGCGTTGCGAGAAACTCGCCTACCTGTTTTTGAACAGTAGC
AGGGCTGGTATCAGCAAGCCGATAGGCAACCTCTCCTCCACCAAGCCCTGAACTACATAGTGATAGCGTTAACGGAACGCGAGGGTGGGTGAGACCGTTT
ACGTAGAACGGAGTATAGCCTGTAGAGGCATGAACAGCGTTGTTCAATGCAAACTCAACAACAGGGAGCATGGAGCTCCAAAGCTTGGCGTATCAGCGCA
AACACTGCGCAAAATGTTATTAATGACGCGATTAACACGCTCAGTTTGCCATCGGTCTGCGGATGATCCGCTGTGGACATGTCCAAACGGGTGCCGAGCA
CCTTGAAGATGGACTTCCAAAACTTCCCCGTGAAGCGGGATCTCTATCAGAACCAATCGCCACTGGTAAGCCATGTTGTCGAAACACACGGTCGATAAAC
AGATTCGCTATACCTTCGGCATCAATAGAGTCCGGCACTTCCGCTAGATGAGCCATCTTGCTCAATCAGTCAACAAAGACCACAATGACAGTGTTGCATT
CCGAATCTTTCGGTAGGCCAAACACAAAGTTCATACTCATGGACTCCTAAAACCCATGGGTACAGGCAGACTAGCCAGCGGCGCCGCCGCATGTGCTGAG
GGTTCCACCCGTTGACACGTTTCACACGCACGCACATAGTTTCTCACCCACTGGTATTGTTTGGGCCACCAAATAGCCTGGCTCACTGAGGTATAAGTCT
TCTCACGATCGAGATGACCACTTAAAGCGGTATCATGTGCCTCTTAGAGTATTCGATACCTAAACTCCTCATCATGAGGGACAGCGATACGAGGATTATC
CTCAATATCTGTGCGATAGCACAATAGGCCATTATCGATAGAATATCGATGTAGCCTCGCACGTAAACGCGCCGACAATTCTATTTCCGAGTCGTTAAAT
CCCTCACTTCCAATAGCACGTAGCAAAGCTACACATTGTTCATCCTTGACATAAGCCGCACGGATTAAGTCTGTGACTGACGATGACAGCGTAGTAACGT
GAGCAAGCTCATAGTCAGGTCGGCGCGGTAGCGTATCAGCCAAAGCATTTTGCTTTCCTGGCTTATACTTCACTTCGAAGTTATATTCGGCAAAGAGTGA
AAGCCAAAGAGCCATTCTCTGAGAGAGATGCGGCGACTGTGTCGTAGTGCGCAATGCGGCATGATCTGTATAGATCACAAATGGCTTTGAGCCAAGAAGA
TGTACTCTGAATTTGACTAGAGCGTACTTCATCGCAAGTAGCTCTTTTTCATGAACTGGATAGTTCTTTTCAGCAGCTTTGAGTTGTCGAGATTCGAATG
CAATGACGCGTTCGCGTTCATCGACATCTGTTTGTAACAGAGCACTGCCTATGGCAAAGTCAGATGCGTCACAGACGACACTGAAAGGCCGATCAGGATA
GGGCAAAGCCAGTATTGGCGCATGAAGGAGGCTTTCCCTAACCGCTTGAAAAGAATCATGTTCGGTGTTACCCCAACACCAATCCACATCCTTCTTAAGG
AGATTGGATAATGGCCGAGCCATATCTGCATAATTTGCACTATACTTATGCAATTAATTGGCAAGGCCAAGCAACTTACGTAAATCTTTTTGGTTCTTTG
GAACCGTCCAATCGACTATGGCCCTTACCTTAGCTGGGTCCGCTCGAAGGCCTCGCTTCACAATGAAGCACCCCAGAAAGAGAATCTCTTCTGCACCAAA
GATGCACTTAGAATCATTTGCATACAACTTATTCGTGCGCATGCACTCGAGTACCGCTCGTAAATAATCAATGTGATTATCCACATCAGTTTGACCGTTC
TTTGCACCTATGGAAAAAGACGTCATCAAAGTACGTTTGTGCATAGCCTCGATGAAGTTTGAATAGTTGCGTCACTAGACGATTAAAAGTAGCCGGGGCA
TTTGACAGCCCTTGTGGCATAACGAGCCACTCCCAGAGCATACCGCTCGGGGTACTAACCGCTGTTAGCGAAATATCGCTTGCTCGCATGAGCAGCTGGT
AATAACCATCGACTAAGTCGAGCGCACTGTACAATGTACATCCCACCATATTGTTCTGAAGAACATCTTTTCTCTGGGGATTCGTGTCTGAGCCGGGATA
GTGGCAGCATTGAGCTTATTGTAAGCATGCATAATACGCTACTTAACATTAGGCTTTTTGACACAAAATGTAGGTGTGGAATGGGGAGACTTACTTTCCC
GCACCATTCCCGCCGCGTGCTTAGCACGAAAGAAATCGTCAATGACGTCATATTGTTCCTTAGGTAAAGGCCACTGCCGTGTTACACAGTATTTAGTTCC
TGGAACTAGGTCAGTTTCATGACGTACACTTCTATCGGGAGGTAATATAGATGGTGGGTTGTGACACACCACATCTTGAAATTCCTTTACAAAAGTATAG
AATGGATCCAAAGGATTCTTAAGGATCGAAGATCCACTCCGGGGCACTGAGTGCCGCCTTGGTGTCCTCTAGGACCGACTCATCCATTGATGAGGACGAG
TTCAACTCGACATCGGGTCTAATGACCACTAATTCGGATAAATCTCCTGCCTTTAAGGCCTGGCTAAACTCGCCATCAGACATTTCGTCTAGCTCACAAA
GAGCATCCAAAGATGGAAGGTATTTCAGTCTAACATTCCCCTCAACCTGGCCAGTCACTCCGTTGACAAGTGTATATAGTGTATCACTATTGTCACTATG
TGACTGCTCGGACGCCTGGCGCTTAACAGTTGCCACCTGGCGTCCAGGTCGTCTCTTCGATGAGACCTTACACCCCTCTGGGGTCGGGACAATAGTGTCC
CCGTGGTTACTACTAGTAGTAGTACGATCTATACGAGAGCTGATGTCTTGATCGACATCCGGTGAAGTGTTACATAACTCGAACTTCACCCAGTGGATTT
AAAAGTGCCACTCCACTTACATTATACGGGCCTAGCCCTGAACTTAATGGTGTTTCGCCAACAATGTCATTACCGACATTAAGTGTGGTGCCTTCACGGC
CGACCGCACTCGGTGCATTTTCACGTGCCACCACACACACATTAAAGGAATCAAATTCTTGATAACTCGGCCCTAGGCCAACCATGCTTTCAGCATGCAG
TGACTCGTTATCACAACGAGTAACACTCAACGTAGTACGTGCCGTATCACTAAAACTCAACGAGCTACGCTCGGAATTCATGTTTTCAACATTGGAGTTA
GTTAACTCAGACATTCCAATGTCCAGCACATTGACATCTTCTGTCAAAGGCTCGCTTCAATAGTGATTTTGTTGCCTAGCAAAGGTGGGTTCACGACTCT
CCAAAACTTCGCTAGGAACATTGCGCGTAGCGCCTAATGTCTTCGACCTCCAATCAATCCATGGCTCATGGCGTTCAAGCCAAGCCATACCTAGGATGAG
ATCATATCTCGAGTCCAAATCAAGGACAAGACAGCGTTTAATGCTATCAAAGTCCAAAAA