Description :
From Genome Similarity Track
Location :
Scaffold_16:154682- 160307
Sequence
5625 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCGGAGACGATCGAAGTGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGGAGGTGACGACGACTGAGATTGTCGAGGAGAC
CGTGGAGGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGAGGAGACG
ACGGAGGTGACGGAAGTGACGACGACTGAGATTGTCGAGGAGACCGTGGAGGAGACCGAGGTGACGGTGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCA
AGCCGAAGCGCAAGCCTACTGCGGGCACGACCGAGGAGGAGACGACGGAGGTGACGGAAGTGACCACCGTGGAGACGGTCGAAGTGACCGAGGAAGTGCC
GGCCACCACGGAGGAGACGACGGAGGTGACCGAAGTGACCACGGAGACGATCGAAGTGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGGAGGTG
ACGACGACTGAGGTTGTCGAGGAGACCGTGGAGGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCAAGCCGAAGCGCAAGCCGA
CTGCGGGCACGACCGAGGAGGAGACGACGGAGGTGACGGAAGTGACCATCGTGGAGACGGTCGAAGTGACCGAGGAAGTGCCGGCCATCACTGAGGAGAC
GACGGAGGTGACTGAAGTGACCACGGAGACGATCGAAGTGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGGAGGTGACGACGACTGAGGTTGTC
GAGGAGACCGTGGAGGAGACCGAGGTGACGGAGGGCAAGAAGCCCAGTCAAAGAAGAGCCGCAGCTGAAGCGCAAGCCGACTGCGGGCACGACCGAGGAG
GAGACGACGGAGGTGTACGCAAGTGACCACGTGGAGACGGTGGGAGAGTGGAATGGAGGAAGTGCCGGCCACCACGGAGGAGACGACGGAGGTGACCGAA
GTGACCACGGAGACGATCGTAGTGACTGACGTCAAGCCTGAGGAGACGACGGAAGTGACGGAGGTGACGACGACTGAGATTGTCGAGGAGACCGTGGAGG
AGACCGTCGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGAGGAGACGACGGAGGT
GACGGAAGTGACCACCGTGGACACGGTCGAAGTGACTGAGGAAGTGCCGACCACCACGGAGGAGACGACGGAGGTGACGGAAGTGACCACCGTGGAGACG
GTCGAAGTGACCGAGGAAGTGCCGGCCACCACGGAGGAGACGACGGAGGTGACCGAAGTGACCACGGAGACGATCGAAGTGACCGACGTCAAGCCTGAGG
AGACGACGGAAGTGACGGAGGTGACGACGACTGAGATTGTCGAGGAGACCGTGGAGGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAG
CCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGAGGAGACGACGGAGGTGACGGAAGTGACCACCGTGGAGACGGTCGAAGTGACCGAGGAA
GTGCCGGCCACCACGGAGGAGACGACGGAGGTGACCGAAGTGACCACGGAGACGATCGAAGTGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGG
AGGTGACGACGACTGAGATTGTCGAGGAGACCGTGGACGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCAAGCCGAAGCGCAA
GCCGACTGCGGGCACGACCGAGGAGGAGACGACGGAGGTGACGGAAGTGACCACCGTGGAGACGGTCGAAGTGACCGAGGAAGTGCCGGCCACCACGGAG
GAGACGACGGAGGTGACCGAAGTGACCACGGAGACGATCGAAGTGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGGAGGTGACGACGACTGAGA
TTGTCGAGGAGACCGTGGAGGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGAC
CGAGGAGGAGACGACGGAGGTGACGGAAGTGACCACCGTGGAGACGGTCGAAGTGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGCGAGGTGAC
GACGACTGAGATTGTCGAGGAGACCGTGGAGGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCAAGCCGAAGCGCAAGCCGACT
GCGGGCACGACCGAGGAGGAGACGACGGAGGTGACGGAAGTGACCACCGTGGAGACGGTCGAAGTGACCGAGGAATTGCCGGCCACCACGGAGGAGACGA
CGGAGGTGACCGAAGTGACCGCGGAGACGATCGAAGTGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGGAGGTGACGACGACTGAGATTGTCGA
GGAGACCGTGGAGGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCAAGCCAAAGCGCAAGCCGACTGCGGGCACGACCGAGGAG
GAGACGACGGAGGTGACGGAAGTGACCACCGTGGAGACGGTCGAAGTGACCGAGGAAGTGCCGGCCACCACGGAGGAGACGACGGAGGTGACCGAAGTGA
CCACGGAGACGATCGAAGTGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGGAGGTGACGACGACTGTGATTGTCGAGGAGACCGTGGAGGAGAG
CGAGGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGAGGAGACGACGGAGGTGACG
GAAGTGACCACCGTGGAGACGGTCGAAGTGACCGAGGAAGTGCCGGCCACCACGGAGGAGACGACGGAGGTGACCGAAGTGACCACGGAGACGATCGAAG
TGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGGAGGTGACGACGACTGAGATTGTCGAGGAGACCGTGGAGGAGACCGAGGTGACGGAGGGCAA
GAAGCCCAAGTCAAAGAAGAGCCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGAGGAGGAGACGACGGAGGTGACGGAAGTGACCACCGTGGAG
ACGGTCGAAGTGACCGAGGAAGTGGCCGGCCACCACGGAGGAGACGACGGAGGTGACGGAAGTGACCACCGTGGAGACGGTCGAAGTGACTGTGGAAGTG
CCGGCCACCACGGAGGAGACGACGGAGGTGACCGAAGTGACCACGGAGACGATCGAAGTGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGGAGG
TGACGACGACTGAGATTGTCGAGGAGACCGTGGAGGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCAAGCCGAAGCGCAAGCC
GACTGCGGGCACGACCGAGGAGGAGACGACGGAGGTGACGGAAGTGACCACCGTGGACACGGTCGAAGTGACCGAGGAAGTGCCGGCCACCACGGAGGAG
ACGACGGAGGTGACCGAAGTGACCACGGAGACGATCGAAGTGACCGACGTCAAGCCTGAGGAGACGACGGAAGTGACGGAGGTGACGACGACTGAGATTG
TCGAGGAGACCGTGGAGGAGACCGAGGTGACGGAGGGCAAGAAGCCCAAGTCAAAGAAGAGCCGCAAGCCGAAGCGCAAGCCGACTGCGGGCACGACCGA
GGAGGAGACGACGGAGGTGACGGAA