Description :
From Genome Similarity Track
Location :
Scaffold_19:154644- 156137
Transcript NameFunction/comments
Aphas_H257_08487Hypothetical protein

Sequence
1493 bases(100 bases per row)
CCATCACGTGCGCAAAGCACGCCTGCCACCCGTGGGGCGCCGCACCTACAAACAAGAAAAAACAAATATTATTTTTGAATTCCTACGATAATAAGACGAC
GGAATACATTAATTATACATTTGAACAAGTCCAACCCACACGTGTAATTAGCCGCATAGCCTATTTACAAGTAAAACAAAACCACCACTTGCATGAATGA
ACGTACATACAATAAAACCAAACTCCGCCGTATATATTTATATATATATGTGTGACTCTGGACGAACTTTACGTACAAAACTCCGTACAAAGAATTGATC
GATAGAATCCAGGCACAAAGTAAACCATATTTTGGGTCAAAATACAATACTGTACCTTGCGCGAGCCAGTGGGTCCACTGCACCGAGGTGGCTTTAGCTA
GTGCCACAAGGCGTTGCGCCAGCACTGGTTCATTCACGTCTCGGGTCCAAAACGATGGCTTTGAACCCTCGTATGAGGCGGCAATGTACAGGGCGGGGTG
AGTACTGGGGCTCGTAGCGGACGCATCAAACAGTTTTTGCACTTGTCGGCGGTCATCTTCGGTCATATGCTGGTGCAAATCAACAATCAGGGGCTGCGAA
GTCCAGTCAAAGCGGCCAACTAGATGCAGGACCCGAGTGAAGCCCGAAAGCACCGACTGCGGCGGCGCCGGCGTCAAGAAGACGGCCGCGACCAGCAATT
CACAGCTTTCGAGGGGCATCACAGTCGTAGCCAGGTGCGCGTCGAGCCATTTCATCCACAGGCGCACCGTGGGGGCGTACGCAGCATGTTGTGTACTTAG
CGCGTGAATCATGGGGGCATGGAGGGCGCCAATCTGCAGCGAGTTGATCTTTTCCCGACCAGTGACTACAATCACCAGTCGAAATGGAAACCCCCCCACG
AGGATATCGAGTCCCGTCGAGTGCACTTGGCAAGTGCCTACTTTGGCCAGCGCGACAGCCAATTGCACGTAAAACCCAAGCTTGGCATTTGCGACACCAT
CCGGCGTGGATGGCCACGACGAAGTCGACTCGAACTGCAGCACCACAATGTACGGGTCGAGGGTGGTGGTGACAAACTTGGCGCCTTGGGGGGTGGAGGA
GGGGGAGGGGGTACCGGCGAGGGGATGGGGGGTCGGGGGGGCGGCGGATGTGCGGCGCAGACCCGGGGCGAGTAACTGCAGATCCGAGACCTTTAATGGC
AGCACCGACTCGTCAAGGGATCGAACGCTGCTCTGCAACGTGGCCCAAGCCCGGAGCAACGGCGCCACCGAGTACGCGTCGTCGTTCCATGTGTCGTTGG
AGGATACAATTGCATCGCCATGTACACTCGACTGGTCAAAGTGAAACGGCAAGATCGTACGCACAATCTGCGACACGATCTGGGACGTTGGCACGTCGTC
CCAGACGACTGCTTCGACGATTGAACCGTCTTTGAACCGCCTTAGCTCGGCTTTGGACTTCCAGAACGCGCGAAACGTGGCAGCGTCCGCCTT