Description :
From Genome Similarity Track
Location :
contig_31:154643- 155644
Transcript NameFunction/comments
g7475.t1hypothetical protein

Sequence
1001 bases(100 bases per row)
GTTGAACCTCAGGTAGGAGGCTACCCCACAGCCACTTCGAGAAGAACCTGGCTCATTCTTCCGAAGCCCAAGCAAAACTTGAAGATTGTGGCGCGTTTCA
TATTCGACATGTAAAAGGCTGCTCACCATATATGTACAAAATGACCGCAAATTGGAGTTATTTTGCTACGAATCAAGTACTTGTCAACACTGTTTATTTG
GCTACTCGTGTGGAACGTGAATCTTCGATGCCGGCATTATCACGAACCGTAGCGCTAAATTTCTGCAAGACAGGGCTTTCGTGCTCTTAAAAACAAACTA
TTCGCCTGGGTCCTGACCACTCTGCCTTCCACGTGATATATGTTGCTACGCTGGTAGTGAAACCCGAGATTTTAACGTTAGACTCCAATTTGCTTGGATT
AGGGATTTACAAGTCGGCAGCCGTGGAGTTCTCCTTTGAAGCCCCATTGGCATACTGTGACGACTTGCGAAGACAGATACCAACCAACATTGATGCAGAA
GATTGACTCGGTGCTTAACGTTACATTTGGCTGGAAATGTGTACGAGCATCGCATGCGAGCACACAAATAAATTGACCTCCTCTACGTGGCTGTTTTTAC
CTTGCCACGGCGCTCTGCAACATTTCAAATGATCCCTACTATGCAGGAACAGAGAGCTCATGGAACGTCTTGTATCGGTCGAGCTCTCGATTGGGGGTAT
CGGCTTCTGCGTAGGTGGCTCAAGTTACAAGTCGGTCATCGAGGAGGCAAGTATTCCGTTGAACGCCTATTGGCGCTGGAGGAGTACACTAGAACCGTGT
CCGCTGCTCGTGTGCTGTTCGTTTGCGTGTGCACTCCTTTACCCATAATATGCGTCTCCGTGGCACAAGAAATGCTGCCCCTGCAAGACCCCAGTGATGG
TTCGTACGCAAACTACGGCTTCTGGGTCCGAACAGGCTTAGTCACAGGCGTGGTCGCTGCTGCTACAGCAGCACAAGCTCATTTCATGGTGGACCGAGTG
A