Description :
From Genome Similarity Track
Location :
contig_31:154642- 157555
Transcript NameFunction/comments
g7475.t1hypothetical protein

Sequence
2913 bases(100 bases per row)
TGTTGAACCTCAGGTAGGAGGCTACCCCACAGCCACTTCGAGAAGAACCTGGCTCATTCTTCCGAAGCCCAAGCAAAACTTGAAGATTGTGGCGCGTTTC
ATATTCGACATGTAAAAGGCTGCTCACCATATATGTACAAAATGACCGCAAATTGGAGTTATTTTGCTACGAATCAAGTACTTGTCAACACTGTTTATTT
GGCTACTCGTGTGGAACGTGAATCTTCGATGCCGGCATTATCACGAACCGTAGCGCTAAATTTCTGCAAGACAGGGCTTTCGTGCTCTTAAAAACAAACT
ATTCGCCTGGGTCCTGACCACTCTGCCTTCCACGTGATATATGTTGCTACGCTGGTAGTGAAACCCGAGATTTTAACGTTAGACTCCAATTTGCTTGGAT
TAGGGATTTACAAGTCGGCAGCCGTGGAGTTCTCCTTTGAAGCCCCATTGGCATACTGTGACGACTTGCGAAGACAGATACCAACCAACATTGATGCAGA
AGATTGACTCGGTGCTTAACGTTACATTTGGCTGGAAATGTGTACGAGCATCGCATGCGAGCACACAAATAAATTGACCTCCTCTACGTGGCTGTTTTTA
CCTTGCCACGGCGCTCTGCAACATTTCAAATGATCCCTACTATGCAGGAACAGAGAGCTCATGGAACGTCTTGTATCGGTCGAGCTCTCGATTGGGGGTA
TCGGCTTCTGCGTAGGTGGCTCAAGTTACAAGTCGGTCATCGAGGAGGCAAGTATTCCGTTGAACGCCTATTGGCGCTGGAGGAGTACACTAGAACCGTG
TCCGCTGCTCGTGTGCTGTTCGTTTGCGTGTGCACTCCTTTACCCATAATATGCGTCTCCGTGGCACAAGAAATGCTGCCCCTGCAAGACCCCAGTGATG
GTTCGTACGCAAACTACGGCTTCTGGGTCCGAACAGGCTTAGTCACAGGCGTGGTCGCTGCTGCTACAGCAGCACAAGCTCATTTCATGGTGGACCGAGT
GAATATCTCTCAATGGCAACTTATGATGATTAGTCTATCTGTTGGCAGCACGTTCCCAGCTATTGCGATGGTCATAGCCTCTGCTCTGGTTTTCCCGGTT
CCATTCATCGTAGTTTCGGGGCTTCCTTTGTTTTACGTGCTGTGGATCGGATCAATTCGCGCAATTGTTGGGAACCAGGTCGTCCTCGATATCACAGCTA
ACCGGACTCAGCTCATTCACTACATCAGGTATGTCTGCGCTGAAAGCGCGATGGTCGTCATTTATCCAGCCTACCAAATGTTGTTCACGGTTGTAATCAA
CACGCGCTATGAACTTGCAGTGATCTTACTACTGCCTTTCATCAAGTTGCTCATGAAGAACCTGCTTTGGCTCAACGCAACTCATCTCCACGACTTAATG
CCTGAGGCTGTCATCTTCACTGCAGACTTTTTCAACTCGTTCTATATGGCCACGTGCATGCAACGCGCATCGTCATTTACCACGATAACTACGATTGCAG
CGATTGACTTTTGCCAGACAGCGATCGCATTATACAGCCTCCACAACCACACAAGGAGTATTCGCGCTCGCGTACGTGAGGTGTTCAGTGCATGCGACGG
TGACAGCTTGTTGGAGTCAATCTGCTTGTTGTTTCGCGACTCGGATAATTTCACGAAGCAAGCGCGTACAGGGATTAATCTGCGCTCGTGTCTGCAGTAT
TGTCTATCAGATACCAGCAATGAATTGGTCGACAATCTCGAAAGAGCTTCCAACGAGCAAATGACAAAGCGTAAGAAAAGCACCTCATTTCGTTCGCAGG
TTGTTCCTTTCAACGATATTATTCAGCCAACAATGAACGCCATTCCGAAGCTCTTATCACCCACCGATCAATTGACTAAGTCTGCGGTCAAGCCGAGGCA
CATCGATCGACAACAAAGCGTAGAAGGCTTCACCATTGACCCACTACACACCAGATCCTCGCATTCTCTTCGTGAAGCACTCGAGACTCTTTTCACGTCG
GAATGCCATGTTTTGACGGAATATCTAGAGTCTGTGATCCCAGTGCTGTATGGGTGCTTAGTGCTGGTGATAGTTCGCCTCCCGAATGCAAAATATCACA
TCGACTTGGAAGACACCACGGTCGAGAGTGCGAATTCTACTGTCACCAGCGTTTTCATCTACGGTTTGCTGGAAATCGTGTCCTTTGTTGTGTTAGTCGC
TGTCATGCAGCGGAACTGTGGAATGAATGCACTGTACCAGTTAGCTTTCGTGCTGGAGACACAGGTGGTTCTGGTACAGAGCAATCTAATGTCGTGGGTC
TTGATTACCCTGGCGTTCCGGGTCGTGCACTTCGGTAAGGAAACCTCGTTATGAATGCTAACTCCAGGGAATTCGCTCTAACAAATGATTGTGTACTGTG
CACGGCCGTTGTTGCATGCAGGGGTGGACTTTACTTTCCAGTTTGCTTGGATGGGCGACCAATAAATCTAGTGTTTATTTCGTGAGTCCTCGAGCAGTTT
TTGTCCACAGCATTTTCGAGATATGGTTCTCACGCGCAGCCCCTGCATAGCTACAGTTTTTCACTCTTGAAATTTGCGCAGATAAGCAATTGGGGGTTAG
ACGGCACGCCAAATGAACACAATAAGGGGAAGAAAGCTAGAGGGGCATCAATGCGCATCACTGATTTTTATGCTCACGAGTACACATAGCTTCCTTCACA
AACAAGTCACGGTAGCTAGTAAACTCGAGAAAAAGAAAGCGCAAGACTTTATCCGAAAGATGAAGCAACCATGCAAAAACTCACGAAAACTTAAGAAGCA
GAACAGTGCAACGTCCGTGTTCAATGAAAGAAGGACCAAACGACTCAAACCTTCACGCAGTTTGAGTAAAGCATTCAAAACAACCCCTTCACGACAGTTT
ATGAGCCACTTCA