Description :
From Genome Similarity Track
Location :
contig_31:154630- 155631
Sequence
1001 bases(100 bases per row)
TGCCAAATCCATCATCGTGCGAGAAAACGCTTGGTGTTGAACCTCAGGTAGGAGGCTACCCCACAGCCACTTCGAGAAGAACCTGGCTCATTCTTCCGAA
GCCCAAGCAAAACTTGAAGATTGTGGCGCGTTTCATATTCGACATGTAAAAGGCTGCTCACCATATATGTACAAAATGACCGCAAATTGGAGTTATTTTG
CTACGAATCAAGTACTTGTCAACACTGTTTATTTGGCTACTCGTGTGGAACGTGAATCTTCGATGCCGGCATTATCACGAACCGTAGCGCTAAATTTCTG
CAAGACAGGGCTTTCGTGCTCTTAAAAACAAACTATTCGCCTGGGTCCTGACCACTCTGCCTTCCACGTGATATATGTTGCTACGCTGGTAGTGAAACCC
GAGATTTTAACGTTAGACTCCAATTTGCTTGGATTAGGGATTTACAAGTCGGCAGCCGTGGAGTTCTCCTTTGAAGCCCCATTGGCATACTGTGACGACT
TGCGAAGACAGATACCAACCAACATTGATGCAGAAGATTGACTCGGTGCTTAACGTTACATTTGGCTGGAAATGTGTACGAGCATCGCATGCGAGCACAC
AAATAAATTGACCTCCTCTACGTGGCTGTTTTTACCTTGCCACGGCGCTCTGCAACATTTCAAATGATCCCTACTATGCAGGAACAGAGAGCTCATGGAA
CGTCTTGTATCGGTCGAGCTCTCGATTGGGGGTATCGGCTTCTGCGTAGGTGGCTCAAGTTACAAGTCGGTCATCGAGGAGGCAAGTATTCCGTTGAACG
CCTATTGGCGCTGGAGGAGTACACTAGAACCGTGTCCGCTGCTCGTGTGCTGTTCGTTTGCGTGTGCACTCCTTTACCCATAATATGCGTCTCCGTGGCA
CAAGAAATGCTGCCCCTGCAAGACCCCAGTGATGGTTCGTACGCAAACTACGGCTTCTGGGTCCGAACAGGCTTAGTCACAGGCGTGGTCGCTGCTGCTA
C