Description :
From Genome Similarity Track
Location :
Scaffold_157:15463- 20416
Transcript NameFunction/comments
Hyaar_Emoy2811426DALR anticodon-binding domain-containing protein

Sequence
4953 bases(100 bases per row)
AGTTTGAGAGGAAGTTATACTAATCTGTGGTTAGTGCACAAAAAGTTAAGTTATACTCACTGCTGGAGACGCTCTAAAGATGTTCGGCAAGACCAAATCT
ATAAGCGGCGAATCTTCAGGTCTAGTCCGATCATTTGGCAGTCTTTTGACATGGATCATACGCGCGCTATAAACATATTCAATCATCCCAAAGCAAAGTT
TACGTAGAGCTGCAACGTGCATGATTTCTCATTTACGGTTCATTCTTTCCGGCTCCTAGTCATTCGTCATGTCGATGTGTGAACGCCTAACGAGGCATGC
ATTGTGCCACTCTGTGTTCTGGACGCGCTGCAATGTGAATAGAAGTGTTGATTCTGCCGCCACGATGAGCCAAACGTTTTGTCGATGATGTTCCGTGACA
AATGCATTGCTTTGTCTTCCAGAGTACGATGTTCAGCGCAACGAGTCTGCTTCAAAAGTGGTGCAATCAGTCCCAATTTGTTTGAAGAGGCAACGGAGCG
ATTGAATTCAGACGTTCGTCTGTATCGACTCCTCAGTCGAATGACCTGACGCAGCCGACTTACAGAAACTAGAAAAGTGATACAGTGAGTGGTTCCATTA
CGGGAGTCCTAAATACCACTTTTGTAGCTGAAGTCGGAACGACGATACAATGATGCTGCATGCTACAAACTCGAACACGTAGCTACACGACCACATTTGA
AGTCACATGCTCACGTATGAGCGCATATTGTTTCTACGTATGATTTTAAGCCCTAAAGACGTAATCAAGTTTGGTAAACAGTCACAAAAATATTAAAGCG
TGGCACATATTTCCTTCCGTACAGTCTATGAAAGCCACGATTTCGATTCTCTCTCCTTGTATCATCCGTAGAATCGATCGCTCTACTAATTGCTATGTAA
CAAGTCTGAAACACAAGGCAGCGGCAAGTCTATATTGAATTAAACGCTGCTGAGAATGAAGAATGCGCTCATCGGTCTTTGACACTCAACTCGAGGTACG
GGATGGCACATTGTGTGCAAGCGTTGCAGCATACTCGTGTCGACTGCTCTCTTATCATTATAACTAAGCTCAATACGATATCGTCAAGGCAAGTCTATGG
ATAAGTGAATTGGATTATAATGCTTGTGGTGGTTTGCATCTTTCTGTTGACTGTTGTAGACGATCTAGTCGTTACAACGTATCGAGATGTGGCACGCCGG
TCTCGGATTTTTTGCTGCATACCCGAATATGTGTTGTTCCCAGTGATACTGCATATGATTTTTTGTGGTGAGGAGGTTCACGATGGTTTGGAGCTGCTAT
AAGAATGCTTTGATGGTATCACTTCAACAAGAACAATTTGCTTCTTTGCAAGTATCACGTTACAAAAAGTATCCAAAGTTGTTGGTTCTTTCGCCGTACG
ACTTTCGTGGGGTATCTTTTTAGACGTGAGCGCTCACCAAGAAAGATGGCATTTCATGGCAAAATGAGTAACCACACGCAGCGCTTTTTACGGCCGGGGT
CAATAGCTTGAGACAAAGCTGCGCTTCGGTTATTAGTACAGCGTAATGAACAGCTGGCGACAGATATTGTCCGGTAATAGCCGGATTAGGCTTACTATGT
CAAGCACGACGCAAGTATGCTTAATTGTTGCGGTGGTTAAAGATTGCATTGCTACGGAATTTAAACAACGCTAGAAATACTACCGAGAGGCGAGTGTCGA
TCGGCCATAAAGTCTGTGCAGTAAGCTATAAGCTGTAAGATGGGTCGTATCGGATTTGTAATCGATTCATGCTGGGTAGGTGAGTCGCTGTAGTGCTTAC
TCACTAGGCCGTTATTGTCATATCTTTGTGCGGATGGTATTCGCGACAATTAAGACGGAAAACAACGTGTATTGAATGCTGTTCAGCTCGACGGCGCTCT
CGGACAGGAAGAGTTCGATATCTTATCGCGTAAAAGTAATGAACAAAGAGTCTAACGTAAAGTAAGGCAATTACGAGAACTGGTCAGTCTCGTAGTAAAG
CAGAGCTGTTCTTGTATGATCGATCCATTTCTTCCGGATCAACGTTTGCACCTGCGGTCTGTGATACTGAGATCAGTGAAGTTGCGCAGAGTAGTTGTCG
AAGTGGATGAGGTCGAACAAGCGTGTAAAGGTATGATAAGGCATGCGATGCATCGATGTGCTGTACGTGATCCTACGGACTTCGACTGTCACTCGATCAA
TGTTATTTTGACGGCTATTTTGTATTGCAGAATCATCGAACGAGCTATTGTCATCTCTCTCCAAAATCCCTAATGGCTGTTGTCCCAGCATCCGATTTGT
AGAATTCAGCAGTTTTATTCTGATGTGAGATAAATTACGATACCCGTTCGAACAAGCCGACGAATCAAAGCTCATTTTATTGCCTACGATATGAGCTTGG
AAACAAGGTTTCATTACTCTGATCGTGACTTCGATAATTGGCATGCGACCGCCCACGAATGTCGCATGAACTGGTGCTGGGTCATTGTTTCAAATGTTAA
GTGAGGACGACGACAATGTTTTCATTAGAGTAACGTGTTCTGAGCAATGAGAGAGTACTGAAGATCTGTATGTAATCAGTACGCATTGAAGAAGAAGTAT
CTTCTGAAATCTTGGTCCACGAACGCTCATGGCATGTAATATACCAGTGCACATCTGCGCGGGCCATAAAATAATCTTGTTATGTCGAGTGTACACTTGT
TCTATCGGCGATTGCTGTTCGTCTCTCGTCCGAGCAGTGGGCGGAAAACAGCGGGTTGCAGAAAGTCTCCACTGAAATGTTGTTCTCCGATTAATATTGA
TCAGCAATGGACATCATGCGTCGTAAGAGTTAGCATTGCAGTCAACGTCGTCACGACGAGCTTGCTCAGAATTACGCCTGAACCTAGATAGTCCAAAGTG
CTAAATGATGCGATGCCATACCACAGACGCGAACGCTATTTGTCGCGAGAAGCGCAATCGAACAATGTTCACTCGCAGGCAAGCTTGATGTGTACTAACT
TTTTGGTTGAAATGTAGCACAGTTCGTCTGCATGCATTTAAAAATAGGTCCACGCTATTCGAATTGCCTGTCAACTTATCCAGTTTCGTGCTCGTAGCAA
GTCACCTCAAATATCATACGTATCATCTACCTAGTGTAAGCGTAGATTACATCTACTTACCAGCTCAGTTGCTGCTTCAGTTAAAAGCAGACGTCCGCAC
GTGGGAGTTGCCCTTTTAACCACAGAAGCAGTATATGTTGTAGATGTGTGCCGGGTGATCAAGAGGTGCTTAGATTAGAACATACTTTCTGAACTCGGGA
TGCGAGTCACACTTCAGATCATGCTCGTTGTCGATGATAAAGTGAATGCAGAACAGAACAGCAAAAATCAAGTTTGCGCGACAAAGCTTACTGACGTCAA
ACTCATGTTCTAACGCGATACCAGCGCGAACAGATTACAAAAAACGTTTAGTGAAGTCTCAAGATTTGCGAACCAAAGCACTTCCAGATATGTGAATGCT
AGAGCTGGACGCGAAGGTATGGACGGTGTGAGAGCACATCCAAGTCTGACTCTGCCAGTATTAGGAAGTAGTGCTCAAGTATTGAGTATGTGTAGCGCGT
CGGAGAGACGCTAGGTTGTAGTCGCCCCACCTGGTCGACACCCTAGTATGTCAGTACTTTAAATAATACTTAAGTCAGAAGACCACATGTACTGTCGTGA
TTAACCAATCGATATACTACGGCTTTGGATTGCTCTGTTGGTACGCACCATCACGGGCGTTAGTCTCCACACTATCAGCACTTCATCGCTTGTCAAAGTG
ATATCTACTAGACTTATCTTGAGTACAAACAAGCAGCTGAAGATTCAAGGTTTTGAACGAAACCAACAACCTTCACACCTGTACTTGTCGTTCGACATAA
GTCATGGTATTAACGTATCACGGCAAGGTCTTATTAGATTTTCTGTCCCCGTCGTCGATAAGTGGCGAGGATATGAGCATTTGGCGTGGCCGGGCAATAC
AAGGCGACCATATTTTTGCAGGATGCTTCGATATGAGCGATGTGTGCTTGGCATCTAGCTTAAAAATAGTCCAATTATTACGTCAGCAGTCGCTCCTACG
GTCAGATACATCAGATGCAGTCTTATATATGTGTATACGGCTTTTGCAGAGCTCACTCAAACTTCTAGGTCGCAGAAACCCCATCACATCATCAATCCGT
TGGCCTGTAGCCATGTCCCACAGGTCACACAGACATGCTTAAATCCATCAACAGAAAAGCTGTACGTTTCAATACTCTGACCAATTACAACGATATTTCT
TCATCTAGAGGACCACTTATTAACGTTGCATTGCAACATCCAACCAAAGCGCTATAATGTATCGCGTGGTGGACGGCGCACAGCGCGTAGTGCTGCTGGA
CGCACCTGCAGAAGCTTTCCACTTCAATGCAAACACAGACACTATCAACCATCCTCTTCCCACTCACAGTAGCTCGTTACTGTTGTGCCCCGTAGTCCAG
AACTCAGAGAAAACCAGGTTCATTCTACCGAGCGAGAGCGACCCACCCGACGTTGTGATCCACTCGGACATGTGCGCAGTCGCTCTCCATCTGTCAGTCC
TTCGTCAGCGCTGTCCGTGGTTTTATAAGCAGCTGCGGCAGCTCCGGCAGTCGCCACTTATGGCAAATGGGTTCAAGTTACTGAATGAGACGGAGCTTCA
GCACCTTCAGGACAATCCGAAGGACCGAACCCGGTGTCCATTACACGATCCTCATTCCTTGAGGTTGGACTACGTCCGTTGTGTAGCTCATAAATACCAG
ATTGGGTCTAATGGGGACGACAGGACTAGAGGACGGTTTCATCAGCAGGACCGAGCTGTTGTACGGTCGCCGCAGAGGAAACGGCTGCGTCAGATGGACG
ACAAGTCACTGTTAAGTGAAAAATGTGTTGCTCTAACGTCGCGACATACACGG