Description :
From Genome Similarity Track
Location :
contig_31:154629- 157541
Transcript NameFunction/comments
g7131.t1hypothetical protein

Sequence
2912 bases(100 bases per row)
CTGCCAAATCCATCATCGTGCGAGAAAACGCTTGGTGTTGAACCTCAGGTAGGAGGCTACCCCACAGCCACTTCGAGAAGAACCTGGCTCATTCTTCCGA
AGCCCAAGCAAAACTTGAAGATTGTGGCGCGTTTCATATTCGACATGTAAAAGGCTGCTCACCATATATGTACAAAATGACCGCAAATTGGAGTTATTTT
GCTACGAATCAAGTACTTGTCAACACTGTTTATTTGGCTACTCGTGTGGAACGTGAATCTTCGATGCCGGCATTATCACGAACCGTAGCGCTAAATTTCT
GCAAGACAGGGCTTTCGTGCTCTTAAAAACAAACTATTCGCCTGGGTCCTGACCACTCTGCCTTCCACGTGATATATGTTGCTACGCTGGTAGTGAAACC
CGAGATTTTAACGTTAGACTCCAATTTGCTTGGATTAGGGATTTACAAGTCGGCAGCCGTGGAGTTCTCCTTTGAAGCCCCATTGGCATACTGTGACGAC
TTGCGAAGACAGATACCAACCAACATTGATGCAGAAGATTGACTCGGTGCTTAACGTTACATTTGGCTGGAAATGTGTACGAGCATCGCATGCGAGCACA
CAAATAAATTGACCTCCTCTACGTGGCTGTTTTTACCTTGCCACGGCGCTCTGCAACATTTCAAATGATCCCTACTATGCAGGAACAGAGAGCTCATGGA
ACGTCTTGTATCGGTCGAGCTCTCGATTGGGGGTATCGGCTTCTGCGTAGGTGGCTCAAGTTACAAGTCGGTCATCGAGGAGGCAAGTATTCCGTTGAAC
GCCTATTGGCGCTGGAGGAGTACACTAGAACCGTGTCCGCTGCTCGTGTGCTGTTCGTTTGCGTGTGCACTCCTTTACCCATAATATGCGTCTCCGTGGC
ACAAGAAATGCTGCCCCTGCAAGACCCCAGTGATGGTTCGTACGCAAACTACGGCTTCTGGGTCCGAACAGGCTTAGTCACAGGCGTGGTCGCTGCTGCT
ACAGCAGCACAAGCTCATTTCATGGTGGACCGAGTGAATATCTCTCAATGGCAACTTATGATGATTAGTCTATCTGTTGGCAGCACGTTCCCAGCTATTG
CGATGGTCATAGCCTCTGCTCTGGTTTTCCCGGTTCCATTCATCGTAGTTTCGGGGCTTCCTTTGTTTTACGTGCTGTGGATCGGATCAATTCGCGCAAT
TGTTGGGAACCAGGTCGTCCTCGATATCACAGCTAACCGGACTCAGCTCATTCACTACATCAGGTATGTCTGCGCTGAAAGCGCGATGGTCGTCATTTAT
CCAGCCTACCAAATGTTGTTCACGGTTGTAATCAACACGCGCTATGAACTTGCAGTGATCTTACTACTGCCTTTCATCAAGTTGCTCATGAAGAACCTGC
TTTGGCTCAACGCAACTCATCTCCACGACTTAATGCCTGAGGCTGTCATCTTCACTGCAGACTTTTTCAACTCGTTCTATATGGCCACGTGCATGCAACG
CGCATCGTCATTTACCACGATAACTACGATTGCAGCGATTGACTTTTGCCAGACAGCGATCGCATTATACAGCCTCCACAACCACACAAGGAGTATTCGC
GCTCGCGTACGTGAGGTGTTCAGTGCATGCGACGGTGACAGCTTGTTGGAGTCAATCTGCTTGTTGTTTCGCGACTCGGATAATTTCACGAAGCAAGCGC
GTACAGGGATTAATCTGCGCTCGTGTCTGCAGTATTGTCTATCAGATACCAGCAATGAATTGGTCGACAATCTCGAAAGAGCTTCCAACGAGCAAATGAC
AAAGCGTAAGAAAAGCACCTCATTTCGTTCGCAGGTTGTTCCTTTCAACGATATTATTCAGCCAACAATGAACGCCATTCCGAAGCTCTTATCACCCACC
GATCAATTGACTAAGTCTGCGGTCAAGCCGAGGCACATCGATCGACAACAAAGCGTAGAAGGCTTCACCATTGACCCACTACACACCAGATCCTCGCATT
CTCTTCGTGAAGCACTCGAGACTCTTTTCACGTCGGAATGCCATGTTTTGACGGAATATCTAGAGTCTGTGATCCCAGTGCTGTATGGGTGCTTAGTGCT
GGTGATAGTTCGCCTCCCGAATGCAAAATATCACATCGACTTGGAAGACACCACGGTCGAGAGTGCGAATTCTACTGTCACCAGCGTTTTCATCTACGGT
TTGCTGGAAATCGTGTCCTTTGTTGTGTTAGTCGCTGTCATGCAGCGGAACTGTGGAATGAATGCACTGTACCAGTTAGCTTTCGTGCTGGAGACACAGG
TGGTTCTGGTACAGAGCAATCTAATGTCGTGGGTCTTGATTACCCTGGCGTTCCGGGTCGTGCACTTCGGTAAGGAAACCTCGTTATGAATGCTAACTCC
AGGGAATTCGCTCTAACAAATGATTGTGTACTGTGCACGGCCGTTGTTGCATGCAGGGGTGGACTTTACTTTCCAGTTTGCTTGGATGGGCGACCAATAA
ATCTAGTGTTTATTTCGTGAGTCCTCGAGCAGTTTTTGTCCACAGCATTTTCGAGATATGGTTCTCACGCGCAGCCCCTGCATAGCTACAGTTTTTCACT
CTTGAAATTTGCGCAGATAAGCAATTGGGGGTTAGACGGCACGCCAAATGAACACAATAAGGGGAAGAAAGCTAGAGGGGCATCAATGCGCATCACTGAT
TTTTATGCTCACGAGTACACATAGCTTCCTTCACAAACAAGTCACGGTAGCTAGTAAACTCGAGAAAAAGAAAGCGCAAGACTTTATCCGAAAGATGAAG
CAACCATGCAAAAACTCACGAAAACTTAAGAAGCAGAACAGTGCAACGTCCGTGTTCAATGAAAGAAGGACCAAACGACTCAAACCTTCACGCAGTTTGA
GTAAAGCATTCA