Description :
From Genome Similarity Track
Location :
Scaffold_519:15462- 19966
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.17Serine protease family S10
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.18Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.25Conserved gene of unknown function

Sequence
4504 bases(100 bases per row)
AGTGGGAGGCGTCAGCATTCCATGCAGGGTCTGCGTTCCCCGGCGCGCAGGACGAGATCGTCGACCTGTTCGGCAAGCCCAGCGAGTACACGAGTCGCCT
GTTCTCGGGATACTTGCACCTGCACAACGGTGGCGACGCATTCNNNNNNNNNNNNNNGAACCCAGCCAGTCCCGAGAACGACCCCGTGCTGCTCTGGCTC
AATGGTGGACCCGGCGCGAGCTCGCTCTCGGGATGTTTCAGTGAGAACGGACCGCTGCTCGTCAACGAGGACGGACAATCGCTCAAGGTGAACCCGTCGG
CATGGAACCAACGCGCCAACTTCCTTTGCATCGAGTCCCCCGTCGGCGTCGGCTTCAGCTTCAACACCTCAGGGACTTATGTGTCCGACGATTTGTCCCA
AGCTCAAGATCTGTACGACGCTCTGCAGAGCTTCTTCAACAAGTTCCCGTGGCTTCGCGCGAACGATTTCATCATTTCCGGCGAGAGTTATGGCGGCATT
TACGTACCAACGACGGCGCGCGCGATCGTGGAGGGCAATTTGAAGGGCGATGAGCCAAAGATCAATCTCAAGAAGTTCGTCGTCGGCAACGGCGTCAACG
AGTTCATGGGTCTATCCACCGTGCTGTTCGCTTACACGCACGGCGTGCTGAGCACCGAGCAGTACCGCCGCATCCGCTCGAGCTGTCCGGACATGCGCGA
GTACGAGCCGTCGCCGATGTTCACCGACTTGGATCCGAGCTCTCCGTGTGGCGAGGCCTTGGTCTCTGTCTACCTGGCCATGATGACGAGCGACATCAAC
ATGTACAACGTGTACGGAAACTGCGAGGGGAAGACCGAGGACGAGCTCAAGCAGCTCGTGCAGGAGCTACTGGCCGCGCCGAGCAAGTTCCCTCACCCGA
TCGGCAACCCTGTGGGCATGTGTCTCGACTCGTCGGCCATGACCACGTACTTTAACCTGCCTCAAGTCCGCGCGGCCATGCACACAAGTCCGGAGATTGT
CGAGTGGTATCCAGACGCGCTCACGACTGCGTCTGTGAAGATCTACGGCGGGTTCCTTGGCATCCCCGAGTCCAAGATCGCGGCTGCTCGGCTCTTGGAC
TACTCTGGGACGCTGCAGCAGCGCGTGACGCCCATCTGGAAGTTCCTGCTGGCCCACAACGTGCCGGGCGTCATCTACCACGGCGACGTGGACATGGTAT
GCGACTTTTTGGGCGGCACGTGGGCCGTCGAGTCGCTCAAGCTGCGTCGCCTGTCCGGTCGCGAGCCGTGGAAGCTGGACAACGAGGGCAGTCTCCAGAC
CGCGGGCTTCGCGCAGCGGTACGAAGGGATCACGTTCGTGACGGTGAAGGGTGCGGGCCACCTCGTGCCGATGTGGAAGCCCCGCGAGGCGGCCAAGATG
CTCGACCTGTTTGTGCTCAACTGATCACTGATCCTGGTGGGATTTGAAGGGATCATGTTGAACCTACTTAATCGCATATTGCGTCAAATATGCAATATAG
TGGGACCCCTCATCTTGCATTCCAAGCTTCAACTTCGACGTTTCTGCGTCACAGCACTGTTGTAACTCTCACACTTTATATCGCATGCCTGTGCGTACCC
CCCTCAACAATGACGCACTCGCCATTCCCCACTGCGACTGCCGCCGCCCAAGATGGAGCGCATCTACTCGGCCTTCTTCACGCCGCCCGACCGCCGCAAG
GAGGCCCTGCCGCCGCCTCCCGTCACCACCAGCGCGACCCGAGACGAGTCGGCGGCGGACGCGGCCAAGTTCGCGGCCGTGCGGCGCGTGGAGCTCGAGA
AGCTCGTGCAGAACCGCGTGGAGGTCAAGCGCGACCTGTTGGCGGCGGTCCGCGCGGCCGTGCGCGCCTTCGTCTACGCATACGGCGCCAAGGCGTTCAC
GGCGCTGCTGCTGGCGTCGCGCAGGTGGAGCAGCCTCGAGTACGGCTACGCGGACGCGGCGCGGCTGCTGCTCCGCGCGGACACGCTGCGGTTCGGCGCC
TTCTTCGGCTCGCTGGTCGGCGTCTATCGGCTCTCGGAGCTCGCAGTGCGGTGCTCACGCAACGGGGAGCGAGACGCGACGACCAGAGCCATCGCTGGCG
GTGTGGCGGGCCTCGCGCTGCTGGTGGACGCCCCCGCCCGCCGCTCGACGCTCGCGCTGTACCTGTTCGTGCGCATGCTGGACGTAGTCGCGCGCCACCT
CGTGGCCGTCAAGGCGCTGCCGGCGTGGCCGCATGCGAGCGAGTCGCTCTTCGCGCTCAGCAACGTCGCCATCATGTACGCGTTCGTTGTCGACCCCTCG
CTGCTGCCCAAGGTGCGATACATCGAGATGAGACCGCCAGGACGCATTGTGTCGCATTGTGTCGCATTGTGTTGCTTGGTTATGCGCCTAACAATGCTGG
TAATATGTTGTATGTGCAGGGGTACTACCAGTGGATCTGCCGCATGGGCGGCGTTAACCACCAAGGACTTGAGTTCACCGTCCGCCAGCGGATGCGCGGC
CAGCTCGACGCGGCCGGCGCGCCGTTGCCCTTCCGCCCCTGCCAGCCGCACTACCACATGTAGACTCAAGCTTCGAGTAGTGATCGCTCGAGCCAACACC
ATCGACTGACTCGAGCATTGGCTGCTTGTGTTGGTGGACTGTAGGGAGTCGTGCGTGACCCACGCCGTGACCGAGTGGGTCAACGGCCTCGGCCGCTCAC
TGCTCATCTACCTGCCCGTGCACGTGCTGCCGGCGGCCATCTTCCGCTTCCCGCAGCTGCGGCGCGCGCCGGTCGCCATGCCCGTCAAGATCGCCTTCGC
CGCGCTCTGCTCCTCAGCCTTCCTCACGTCCTACCAGGTCAGTGGGCCGCCAACGTCAACCGCATCAAGCCACCGCTGACGTTGTCATGTCATTTCCCAT
CAGACTCTGGTCAAGCTCGTCGTGTGCACCGTGCGCAACGCCTTCCACCGGGATTTTCCCTCCGTCTCGGTCCTCGCGGGGGTACGTGGCTCATTTCCCA
ACTCGCTCAGTGTCGTCCTCGTCTCATGCTGTGCATGTATGGACAGCTCTCGACGGGGCTGAGCCTCTTCTTCGAGCACCCGAAGCGCAGGTTCGAGCTC
ATGCTCTACTGCGTGCCCCGCGCGCTCGACATTGTCTGGCAGGCGCTCGCGCGCCGCGGCCTCGTGCGGTACGTGCGCCACAGCGAGGTCGCGCTCTTCT
GCGTGTCCATGGCGGCCATCATGGCCAGTCCGGCCGCCCACTTCAAGCCCACGTACCTGCGCGCGCTGCGCTTCGTCTTCGGCCGCGACGTTATTTAGCC
GCCGCGCCTTGGTCGTCACACTGCTCCTCCAGAGTGCGGCAGCGGACAGAGACAGCGACGGCGTCCAGGAGCAGCAGCACCAGCCAGGTCAACGGACCTC
CACCCTCGTCCTCCCTTCCCTCAATCAATCCATCGCTTTCACCATCACACTCTTCGTCCTTATAGCCAATTCCCCACTCTTGAAACCTGAAGATAAAAAA
TTCCACAGCCAGCCACGCACGCACACACCGCACACACCACATGCACAAGCCACGCACACGCCACGAGCCACTCGGTCCCGCGCCGGCACCGCCNNNNNNN
NNNNNNNNNNNNCACCTGCCCGTCGTCTTCTAAATATCCGTCGCCTCTCGGTCCAGCCATCTTCGTCCACTTCTTCGTCCGTCCTTCAGGGCTGCTCCTG
CCGCTGGCTTGCGCTCACGGTCGTGCCCTCCTGCTCGCGAAAGTGGCGCTTGCACAGCCCGCGCTTCTGCGCCTGCCGGCCGCAGCCGTCCACGCGGCAA
AAGTACTTCCTCGCCGGCGCGGCGCCGCTCGCATTCGAACTCATAGCATTGGCGCTGGCGAGCGCGCGGGCAGCCTCGGCCTCGGCTTCGGNNNNNNNNN
NNNNCGGCAGCCTGCAGCTTCTGCTCGTGCAGCACGTTGGACGCGAGCGTGACGCGGTCGATGGGGAGCGCGCCGGCCTCGAACGCGCGCAGATGGGTCG
CGCAGAGGCCCGCGAGCTCGGCGGACATCCCGCACCCGTGGACGCGGCACGCCGCCGAGCCATTGCCACCGTCAATGCCGCCATTGGCCTCCGAGGGGGA
CGACGGGTTGCTGCCGAGGCTCACGGGGCTAGTTGCGCCTGGGAACGTCACGGACACACGCACGACGGGGGCGTCGGCCCTGCGGGGTTACTTAGGCCAC
CACGCTGGGGACGGAAGGCGCCACTACTCAAACAGAAGACACGCGAGCCACCTACCTTGGCTGGAGCTGCGGGTCCTGCGCTTGGATAGACGACGACGAC
AGTGATAGCGGAGGCTGCTTGCCGTGCAGCGCGCAGAGCCCGCCGACGAACGAGGCGTTGCTGCAGCCCGACGCGACGCACCGCGTGCGCTCCACGTCGC
GGATCGCGGTCGCCTCGGCCACGGCGTTGCCCACACCGGGCCGGTTCTCCGCGTCCCCCACCACCACAGTAGCTGCTTGTACTGCTCCTGGTCCCTGTAG
CTGT