Description :
From Genome Similarity Track
Location :
Scaffold_639:15461- 17453
Transcript NameFunction/comments
Phypl_g9997hypothetical protein
Phypl_g9998myb-like DNA-binding protein, putative

Sequence
1992 bases(100 bases per row)
CTTACGGATATTCTGCAAGGGCTCAAGAGCGGGGAGCTCTATCGCGTGAACtgtcggcggcttcggctcTTTTCCCGGGCGAATCGACTGCCGTTCGATC
AGTGggcgcttctgcagcactgCAGTCGCATCGTGGTGGAGTTCTTTTGGTCGAATACGGgagtggaggtggcggcgccgctggtTCTGCCTGTTTGGCA
CCAGAAGATCCTGAgcaagctccagcacgcgctgcagcagcggctgctgggcaaggacAGCGTCAACTACGTCGTCAAGGTTGCGCACGACCAGGACGCG
CCGGGCACCGTGCTTCTCTCGCTTGAGAAGTTCCTCGCACGCTGTCATACACACAGCGGCACGGTGgccaccacgaacagcagcagtcagcagcagcagc
aacggcggcaagCCTCCGAGTCTCACGTTGAGCAATaaagatggctacatttcCTGATTGCATGTGCAGATGATTACCCCCACTCTGAGGTCCCCACAGT
CGGGGTAATCACGTCCCTACGATGTCGACTATCAACTGGTACACTGTACCACTCCCGTGAGATTCCGCTACGATATCCGCTGCATCTACACAATCCCAAG
TGTTTGCTACACCTGGGATTTTGAAAGCCTTGACAACTCCATGCTTGCCTTGTCCCGTGCGTGCAGCTGGCTCCACTCGCCCTCTTGGTGGACAGCAAAA
CGAAGTGCGCGACAGGCAAATGCCGAACTCAGGATGACGCTACTCTAGTCTCGCCGCCGGATTCTTGCCTGCGGACGCCATATCATTTCGATCCCCACCG
CGACCAGACCAacgtggcggcgacgcggcagTCACTCACGCGAGTGCCCGCGGGGCTTTGCAGGCCGCGGCCATCCTCACACTGAGGTAagccgctcgct
cgctgcgccgcaACCAAAAAATCCAGCCGCGTCCTGTAATAATAGTCACTTCAAGGTGTGTCTGGTCACCGGTGATCCACCGTGGCGCCCAGCAAAATGC
TGCAAAAAAATTGCTGCCAGCTGGCGAGCCTTGCGACCGCGCGATAGGAAGAGACTGAGGCGGGCTGTAGCCTACAGTGTAGGCTGTCCCCAACAACAAT
AAGCTACTGTATGTCACTAGTTAGTCATGGCAAATGCCAAGAAGGCAAAACTGCAAGCAGCGTTGCCTTCTTGCCGTGGATTTCCGTTCTCTGCCTGAAG
GAAAACTTGATCGCCAGCACTTCGCTGtctcggccacctcggcgaCGGCTCGATTTGTCGTGGCTCGGTTTGTTGTTGTCTGTATTGCAGATGCGTCGCG
AGAATCAAATCGTAGAGCCGGGAAAACCCCGGCGAAATGAACCCACTTTGTGCGGTTTGTCGGTGATGATGCAGAGCATGGTTTGGCGTCACCGtgtcca
cgctgctgctgcgtgtgaCTCTCGTCTACCGCTTGGATGTTCGCCCGCCTCCTGTTCGGATCCCGCGATGCGGTGTTCGACACAAAAGCCTTCGACTAAA
CACCACCAGATCATAATCGCCGTGCACGTGTAATACGGTGctgtaccagcagcagacggacAGCAGACGGAGACCGTATCACACACGCGTTGCAGTTGAG
ACCGCGCGCGGTCCAGGCCTCAGTTCAGAATTCACGACGCCCCGCACACGCGAGCGACCCTCAGTCTTTTTCTTTCAGACCCCATGTTGAAACCCGCGAG
CTGCATCGAGCGAGGGCTCTGGTCGGGCGAGGAGCACGACCGCTTCCTGGACGGGCTCAAGCTCTACCCGCACGGGCCCTGGAAGAAGATCGCCGGCTTC
GTGGGCACCCGCTCGCCGCGCCAGGTGCAGACGCACGCGCAAAAGTACTACGAGAAGGTgggccgccgcctgcgcggGCTGCGCAAGGaccgcaagaagc
tcgtgcgcCCCGAGCACCGCCTCGACGAggacatggtgctgctctgcCGGCTCGCCAAGGACAGGAGTGACCCGAACGGCCGCGTGGACCCG