Description :
From Genome Similarity Track
Location :
Scaffold_620:1546- 3762
Transcript NameFunction/comments
Phymu_g11190propionyl coenzyme A carboxylase (Pi-PCC1)

Sequence
2216 bases(100 bases per row)
gcTGCccccaaggagaagctcttcgacaaGATCTTAGTGGCCAACCGCGGTGAGATCGCCGTGCGCGTCATGCGCACGTGCAAGAAGCTGGGCATTAAGA
CGGTGGCCGTGTATTCAGAGCCTGATGTGAACTCTGTGGCTGTGCGCATGGCCGATGAGGCCGTGTGTGTGGGGCCCGCGCCCTCTAACCAGAGCTACCT
GAGCATCCCCAAGATCGTGGAGGCCGTTAAGGCCACGGGCGCGCAGGCTGTGCACCCAGGATACGGCTTTCTATCGGAGAACAAAGATTTCTGCGAAGCC
CTGGAGGCAATCGGAGTGGCCTTCATCGGTCCAGGCCATGAGGCGATCCAGGCTATGGGAGACAAGATCGAGTCGAAGCAACTGGCCATGGATGCAGGTG
TTAACACTATCCCGGGTTTCCTGGGAGAGATTGACACGGCTGATGAGGCTGTTAAGGTGGCCCAGGACATTGGCTACCCGGTTATGATTAAGGCCAGTGC
TGGTGGAGGTGGCAAGGGCATGCGCGTTGCCTACAATGACGAGGAGGTGCGGATGGGATACAGGCTGTCGAAAGAGGAggcagccagcagctttggcgaT
GACAGGATGttcctggagaagttcaTTGAAGATCCACGTCATATCGAGATCCAATTGATTGCAGACTCGCACGGAAATGTGGTTCCGTTGCCGGAGAGAG
AGTGCTCCATCCAACGTCGCAACCAAAAGGTCATTGAGGAGGCGCCGAGCGTGCTGTTGGACCCTGAGACCAGAATGGCCATGGGTAAGCAAGCTGCTAT
GCTGGCCAAAAAAGTGGGGTACGTGAGCGCTGGCACCGTGGAATTCTTGTGTGATAAACACAAGAACTTCTACTTCTTGGAGATGAATACGCGTCTGCAG
GTGGAGCACCCTGTGACCGAGCTCATTTCGCATGTGGACCTCGTGGAGCAGATGATCCGCGTGGCTGCAGGACATGAACTGCCGAAGAATCTGGTGGATG
GACCAGTAAAGATCCACGGCTGGGCTATGGAGAGTCGTGTGTATGCTGAGGATCCGTTGCGTGGCTTTTTGCCGTCTATCGGGCGACTTTTGCAGTACGA
GGAACCTGTCCACCTCCCAGGTGTGCGCGTGGACTCAGGTGTGAACGAAGGCAGTGACATCTCCATGTTCTATGACCCGATGATCTCGAAACTCATCACC
TACGGCAAGGACCGCTCGGAGTGTTTGGACCGCATGAAGACAGCACTGGACAACTACGTGATCCGCGGTCCGGGTAACAATGTTGCATTCCTGCAGGATG
TCTATCGTCACCCTCGCTTCGTGAGCGGTAAAATTACAACCAAATTCATCGAGGAAGAGTATCCGGATGGTTTTGACGGTGTGAAGCTGACTGCTCCTGA
GATCGAAGACCTCCGCGTCGTCGGCGCGATCATGCATCTGAAGAAGGCTAGCGCTAGCAGCCAGATATCCGGTCGCATTCAGTCGATCTCCGCTGAAGGA
TCTGGATCATTCAGCTCTTTGAACAAAAACGAACTGGAATTTGTCTCGGACCAAGCAGGTGTTGTTCCCCGCCTGCGTGCAATTGCCCCCGATCTATCAC
CTGAAGAGCTGATTGCGCTCGCAGAGCGCAACGATCTCAATAATGTGGGTGCTCAGCTATCGGTTAGCATCGATGGCCCATTCGGAGAGTCGAAACCCGT
TATTGTTGTGGAAGTAGAGGTTGAGAACAAGCGGCACCGCACTGAGACGGTGACACTAGCTTTGGTTGACAACAAATGGCATGTTGTGGGCGGTGTGGAC
TGGTCGTTGAATGGTCCGCTCTTTAAGGCGTCGTACGCGAAGCAGGGCGGTGTAGCAGACATGCCGTTGGCGTCAcaaatgctgcagacgctACCTGAAG
GATTCCGCCTTCAATTCCATGGTGCTGTGCATGACGTGGTTGTgcgcaacgagctggaggctgcgtATGGCAAGCACATGCAACCGAAGCCAGAGATAGA
CACATCGAATTTGCTGCTATGCCCGATGCCTGGCATGCTAGTTTCGGTGGCGGTTGAGGTGGGCCAGCACGTGGAACTTGGCCAGGAACTGGCCGTCgtg
gaggccatgaagatgCAGAATGTTCTCCGCTCCGAGAAGAGAGGCGTTATCAAGAAAATTGTGTGCACTGCTGGTGACTCGCTCAAGGTGGATGAGGTCA
TTCTTGAGTACGAATA