Description :
From Genome Similarity Track
Location :
Scaffold_1361:1546- 2854
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1361-snap-gene-0.4Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_1361-snap-gene-0.5Conserved gene of unknown function

Sequence
1308 bases(100 bases per row)
GTTGCTGTATCCAATTCGCAGCGTGCTTCGTTCACCCCAGATCACGTCGGTCGCGTTCACGCCAAACTGCTTCTCGAGACGATTGCGATGCCTTTGCAAG
AGTTCCAGGAACGAGTTGTCGTCGCATTCGATCAGCTCCATGGGTGTGGTCGGATCACGTTCTTTGCCATCCGAGAGGATGTCCAGGTTGATCGAGTGCA
CATATTCAAGGAAGACGCGGAGCGCACGCGCGACGCAATCCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCA
GTTCGAAAGTTGCCAGCGTAGGATTAGACTGGAGGAAGAGCTTTGCGTTCACGGCCGAAATGGCGTAGGAGATGTCGCCCATCGCGTTCTGTCGTCCTTC
GACTTGCATCTGGTTCTGGAAATATGCCACGAGTGTTCGTAGCGTCTCATACTGCTCTTTCATCGTGATGGTCTTGTACTGCAGCGTCTTGAAGTACTCA
CTGAGTGGCTCCACCACCGACTTGATTGCAAACAGACACATCCACCACGTATCGCTTGGACCGTGTTGCTCCTTCTGCAGATGGAAGTTCTGGATCGTCT
TTCGATGCTTTTCGATAAACTCACAAGTCTTATGGATCGATTCCCACCGCGTCGACGTGTACGTACTGCATTTCCCGATCATCTGCGTCAGCGTTTCATG
AGACCGCGAGAACGCGATCTCCGACGACAACACCGACCGGAAGTTGCAGAAATTGTCAAACACTTCCAAGAAGCAGTCCACAGCCGAGTTCAACTGATCT
GCTGCGCCGCACGAATTCACAGTCATGCCACTGCCGTCACCTTCTTCGCACGCGTTCACCATTCGAGTATCAAACCCTCGATCGCACCCCATCTTCACAG
ACGTTCCATCGGACGCGACACCAATCAACTTCTTCCGGTAATCACTTGGGCACAAACGAGAAAGAACAAACAAAATCAACTCAGCATAGTTGTGGCCCGT
GTGCATGCGTTCGGCGACAGGGATCGCCAGCAAGTGGAAATTGTACAGCTTGCCACGCGCACCAAACGAAATGCGCACATCGAAAAAACCCTCTGTCTCG
TGGCTGGCACCGTCCGTCCAGATCGAATACGCCCACACATTGTCCAGAATCGTCTGGAGCGCACTAAAGTTTATCGCCGTCACGTAACGGACCATTTGGG
CGATCTCAATGGCGTTCGGGTTGCCCAATGTCACGGTGCCGAGCGCATCGGCCACGATCTGCAGATTCCGAGAGACGGCCTGGATCGCGGTGCCTTCCGC
GAGCATGT