Description :
From Genome Similarity Track
Location :
Scaffold_116:15454- 17064
Transcript NameFunction/comments
Phymu_g4700conserved hypothetical protein

Sequence
1610 bases(100 bases per row)
GCCTTGCGCAACTGTGAGCACCGTCAATGTTCTCATTCGATTGCGGTGCTGCAGACTGTGAGCTGTACGTCGTTGAGTTCACACTGTCAAACCAAGCTGG
TGAATTGATATGACACGCATTGTAGGAAGAATACTGAAGCGAAGAGAGAATCAACCTTCTTTACTTTTGTTTTTAGCTGTATGGATTCAGGATTTTTCTG
CAAACCCTGCTTTTGTTTTTCTAAATCTCCGTGTGTCAACGAATCCAATTGTTTGTAGCACCTAACCAAGAAACTCAATGCCCAAAGACGTGCTTACCTC
GTttgtagtaccggtacatgaATCGCAAGTTAAACTCGCGGCGTGAGTGCTAGTAGCACAAGAATTGTTTCAAGGAATTCGCGCGCATAGCCAAAAAGAA
ATGCAGCATTTCTTGAAACAGCTCTTGTCCATTTTAAAATGTTACATTTATTATAGCACCTTtgacttgaagtttgtaGGTTATGCAATTGTGATTTGGT
CCAGATAGATAACTTCAAAGCCGGGACATCGGACCAATAATTTGACAAATTTTTCATCCATTGGTTAAAATAAAAAGCTTCAGTttttgagcagctccga
tcCAGCCATCCATTTTGATCCAGTGCAATGGCATCcgaagcgcgtgctgtgGAGACGGCCCTGGCCCGCAACCTGCTGTCGTCGGTGCTCGCCCTCGCCT
TCCCCAGTGAATTGGAGAGCGACAACGCAGCTCTGGATACCTTTttggtgcagcagaaggctTTATCGTCCGCTCTGGAGCGCCACAACGTGTTCGGATT
GGTGACGGATGGCAAGGCGCTGAATAAATGGCAAACCAGGTtgatgcagctcgtggaaggctcttctgctgctcgtcgcgTTGGCTGGGAGCTTCTTCTG
ACCACGACGCGTCAGAGTCCACTGGAACGACTCGAGTCTCTAgccgtgaagctgctggagcacatcgTGAAGGttctgaagcagcagcagtccTCCAAAa
ctgaagacgatgacgcaGAGGAAGCCACCACTGCTGCGTGCGGTGTGGCACAGGCTCTGCTAATTCATGTGCACAGGTTTAACCCGGACACGCGCcgcga
ggtgctggagctgctagGAAAGCTGATGCAACCATTGGTTGCGCTGCTTTCGAGCAAAAGACAGGCCAGCACGACCTCGTTGGTCGTTGCTCAGCTGGAC
TTGATCGCTACACTGTTGCGTACCTCTCCCAACTCGTTAAGGATCTACGCGGTGAAGATCGAGTCGGCTTGTGTTGGTGCATTGTTCCCTGCTGCCGAtg
gaagcgacgacgatgaggtGGCGGCTCAGAAAGCGACGGTGTgtctggcgctgctgtgcaaCGCCTCGGATAAGCCACAGCAGGTGTGGATGCAGATGGC
TCagaaagcgctggaggctgcgcatcagcagcttgaccTGCTCGCTGGAAAGCGCACCGCGGCGCCGTCGACCGAAGGAGTGACCGGAAAGAAGCTGTGG
GTGCAGGGAGCAGCGAGTCAAAGTTTACCTATTTACCAGCGCGCAGAGGTGACACTGGTTCGGATGGCACGTGCGTTGAGTGCGTTGCACGAACTGTTCA
GTGCTCGCAC