Description :
From Genome Similarity Track
Location :
Scaffold_955:15452- 16718
Transcript NameFunction/comments
Phypl_g11807hypothetical protein PHYSODRAFT_485789

Sequence
1266 bases(100 bases per row)
CAGCAGTACGACGCAGCTGCTTGTGCCGGACGATCTTCGTGTTCAGGTCGTCCTTCAAgtacagctcgtggagatgctTGCGAATTGAGGTGGAGCCGCG
CGACGTGGCCTCGCGGACTTAGAGGGAGGCTAGCACGGCTgtctccgccttcttcccgAGCGACAGGACTTGGTCGCGGTAGTCGTCAGCGCTTGAGTCC
AGCTTCAAGTCGTCAGCGATGAACGGCTTCATCAAggcgacaagctgcttggcgttcgATCGCTGCCTCTTAGGCACGTCTGCCATCCACTGCGGCTCTT
GCGCGTACCATGCGAACCCCGTCGCGTGAAGGTAAGTCACCGACGTCCGTCTGCGCTTGGGTTTGTCATCGTCTTGGTTTGGATCCTGCTGacgcttctt
gttcttgtctTGTGCTGGCGTTCCGTCCACTTTAGCTTCTAGGTTGTCTAACCGCTCGTCTTGGCGCTTGATGTGTGCCATTAACTGGTTATTGAGACTG
TGTTGATGGTCGATGACCTTGCTCTCCTTGCTTTGTTCCTTGTGCAGTGTGGCAGCTTGTTCTTGGCTTGGACCAGTGCTTGCACAGGCGGCGATATGCG
AAGAccgcgcaagaagctcagcgactgACGCCCCACCATTCACAGCAGCCGACTCCAGACGCCTGACAGCAAGCCTGTCGTCGTGGAGCCCCTTCACCAT
GGGGTAGTGCAAGATAAGGTAAGCCGTGAGCACATTGGCTACTTGTTGACTCAGGTTGTACTTGGGGCTCTCCATCTTGTAGCAGGTTGTGAACAGCAAG
CGTTGGACACcggcgatcttctcctgcgtctccgcgTCGAACGGCTTCAAGTCAAGCACCTTGACTGCGGCCTTCGTGTCATACCCGCTGAGTGTCTTAC
TGACCATGTGATCTTCTCTGCTTGTGTTGAAGATGTAATTGAACCCCTTGTGTGTTGTCGACATGTTCCAGGCCTCACGGTCAAAGATCTAGCGGTGTGT
GAGGCCTTCATACCCGTTCGCGTGCTGTGCGCCACCGCGGCGAAACGAGTGCGACGTTAGCGGTGCTacgactccagcagcaggagcgacGCAGTTGAGC
AGACGGTTGACGTAAGAGTATATAAGAGTATACCGtcggaacagcagcggcgggcTTCGGATCGGCAGTGGTAGTTGAGGCGGCAGCGTCAAGGGCGCAA
ATTCGTCGGGGTGGttcagcacttccaccagcGGAGTCGCCGGCGACAGCGTGACGGCGGCTTCGA