Description :
From Genome Similarity Track
Location :
Scaffold_36:154489- 155755
Transcript NameFunction/comments
g3828.t1ETI36213.1 hypothetical protein F443_17581 [Phytophthora parasitica P1569

Sequence
1266 bases(100 bases per row)
TGAAACGCATGGCGCTAGCATGTGACGCGCGGTCTCTTGAGTGCGGCTCGTTCATCTGTCCAGGCATGCGGGATATTCTACTGGGACTTGAAGCTGTAAT
CGTCCGCTGTCGTGTATTCCTTGAGCCGAGTCGCGTCACCTGTGGCTCACAGCTTGCATACGGGCTCTTTCCGTCCGAACGGGTGTCCTCCGTCCACTAA
GCAAACAGCGACATCAGTACAACACGATACACGCCAAAGTCTCCGAACCCGGCTTCGCATGACGATACTCGCCGTATCAGCATTACGGCCCAACTTGTCC
TTGCAGAGCTTCGCAATACTGGACGCTGGAGCTTTGACCTCGTGGTCTAAACCAGCTCTACGCCGACATCTGTAAGCCCCGGACCATACACTTGTCGAGT
ATGAAAGCCTCAGTTACACATGGCAGGGAGCGTGCTGGCCTTTCTCGGCTTCCGGATCGCTGCAACAGCAGACCAGCGCCCGTCAGCGCACGCTCTCCAT
GGCCCGAGACCGAGTCATTTGGTGAAAATCGAAACTCGGCGAACTTGGTTCTGCTCTTGCTGGAGTGGAGTAGGCAAATGGAGTGCCCGCCTTCCAAGTA
CTCAATGTTCTCGCAGCAGTTCTTCGTGGCAGGGTCCCGAGAGACTTTGGGGCTGCGTCGCTCGCGCGCGACCTTCGTCAACCTGCCGCTCACGCCGCGC
CTCTCTGAAGCTCTGCAGCCTCGGGGTGCGACTTTTTGCTGCGCGTCATCGACACCGCGCGAAGTTCGCCAGTCGCGGGACTCGTTTCTGTCGTTGAGCA
GCTCCACCTCGACCGTGTCGTCGACGCGGATTTCGTCGCCTTTGCCGCAGGACATCCGCATCCAGGGATGGGTGTACTGGGCCCGGACCGAGGACAGCAA
GGCCGACAGCCAGTCAAAACGGTACACCAAGGTGTATGCGGTGCTGCGCAACGAGTTTTTGCTGCTCTACCGCAACGACCAACGTCCGTCCAGGAGCGTT
CGACCGCAGCCGCTGGTGCAAATCGCCGTGGCCAGCTCGTACCGCAGCGTGGAAGGCGTCCTGCATGTGGAGGACCCGTACGGCGAGGAGATGGAGCTCC
ACCTGTACGAGCGGCAGGACTACGAGACCAGTCGGTTGTGGGGCGACGCACTCGAACAGGCTTCGGAGCTTACCCACTCGCACTTTTCCAACTTCGACGT
CAAGGTGGAAGACCTCTCACGCGGCAGCGTGTACCGTGGCACGCTGCACGACTTTCGGCTGGGACG