Description :
From Genome Similarity Track
Location :
Scaffold_43:154451- 156010
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14440GPN-loop GTPase

Sequence
1559 bases(100 bases per row)
CAGTAATCAGTGGATCATCGCGCTTAGTCGTGACGATGTGCACGGCCAGGGGCGTCTGATTCCGGTTGTTCACTCGTGAAGCATCGGCGCCGTGCTCCAG
CAGGTACTTTGTGATACGGCGCGACTTGGCCGCGGCCAAGTGTAACGGGGTGTTCTGTCGGTTGTCCACAGCATCAATCAGCAGGCCGCGTGTCTTTTTG
CCGCACAACAACTGCACGGCGTGCAGCTGGCCGAAGCGCACAGCAATGTGCATCGCCGACTGGCCGTGCACCGGATCACGCTCTGTGAAGTCCGTGTTCC
TGTCTTGCAAGCAGGTGCGTAGGAGCTGAAGGTTGCCTGACTTGACAGCGCGAAGGTAGTCAGAAAGACCTTCTTCCGTCACGCGTGGACCGAAGTGCAT
GACGGAGCCACGTCCACTCATGAGATCCGTACTGCGGGTGCTCGCGAACGGGTCGACGCCGCGACTGCTGTCGAATAAATTGCTGCTTCGACTGCTACCG
AACTGATCGTTGCTTCTGGAGCTCTCGAGCCCCATGTTGCTACTGCGACTGCTAGCGTACATGTCGACACTGCGACTGCTTTCGAAATTCTCCGGGGCTA
AGCTATCACGCAACACCATGGCTGTCGTGAGGTCCTGAGGCTTGAGATCACTCGGACGATAGCGCATCATACTGTCACGGTAGCCACTGTTACTGCCACC
GACCGCGTGAGACGCGTCTGCGGACTTCTTCTCTACCGACAAGCGGTCGATCTCCGAGTTGCCACGTGAGTTGCGAGGCACTCCCAGATTGACCATCTTG
TTGTTATCGGCAGGGTTCGCGGGCGCCTGGTTCATGGGCATGCTCTTGCACTTGCGGAGCTTCAGGTCAGTGGTTAGCTTGTCATCCACATTGTTCAAGC
TGCGACGCCCTCCGCTATTATTATGGCGGGACGATGGTTCACTGCGTGGTGGGGACTTCATCGTTGGCATCGTGGGGGGAAAGTAATCGTCGTCATCGTC
GTCATCGTCGTCATCGTCGTCATCGTCGTCATCGTCGTCGTCCTTCTTGTGTTTGCGCTGTTTCTCCTGCTCATCCTCTTCGCCGGCGCTGGAGATAGGG
TCGGTGCCTGGAGACTTGGGGCTGGAGACCTGTGTGTCCGTGACCGAGACGCTCGACGCCTTCTTCATGAGGTTGGGCGGAAACGCCGGCTGCAGACTAC
CACGTGGGGCTGTCATCCAAGCCGGATCGTCCGACACGTCATCGTCGTCGCTATCACCGTAGTACGGAGACTGCTGCGAGTGCTGTTGCTGGTTGGACAC
ACGCACCGAGAGGCTGCCGCGAACGGGTGGCGCGTTGTGGTTCACCAGGCCTTCATGGTAAGGCATGTAGGCCAGATCCAGTTCGTTGCTGCTGCGTGTT
TCCAGCATCAGCGACGCTAGTGGCTGTGTGTATACTAGGCGGCTGCAAGGCCTAAGATAAGAACAGCGCGTGCTCTTCTTCTGGCTGTGGAAATATGGGA
GTGACAGCAGGAACGGTGCACTGGTGCCGTCAGTTGTCGTTTTTTGTTGCAGCTGGGAT