Description :
From Genome Similarity Track
Location :
Scaffold_175:15445- 17769
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_175-fgenesh-gene-0.3Protein H39E23.3, partially confirmed by transcript evidence
Pytir_DAOMBR486snap_masked-pir_contig_175-abinit-gene-0.50Eukaryotic translation initiation factor 2 subunit beta

Sequence
2324 bases(100 bases per row)
TAGCTCAAGTGCCACCACAACAGACTCAAGATGGAGACATCAGCTCCGAGTCCAGTGATGACGACGATGAACGACCAGTTGTGCTCGCGGCGCCAGTGCG
TAAAGCCCCAGCCAAGCCTGTCGCTACCACCACTACTACTGCAAACCCTCACAAAGTGCCGTCCGAGTCCGAATCGTCCTCTGACGATGAACCAACCCCA
CGAAGCGTGCCAGTCGTCGCAGCTCCAAAGTCAGCGGCGGCTCCAGCTGCCGAGAGTTCCTCGTCCAGCGAGGAGGAAGCCTCTTCATCCGATGAGGAAG
AAGAAGAGGTCTCCAAGCCGGTTATGAAAGCCCCAGTAGCGAAGAAAGCCCCAGCTGCTCGTGCTCCAGCGCCAAAGGCGAACCCGAACCCGGGCATCTC
GACGGGCAGCTCCCACTCGCTCGTAAAGAAGATTGAGGCGTACGCCAAGGCCGACGAGACCGAGACGCTGCACCTGGACGCGAACCTGAACGGCTTTGAG
CGCCTGCTCGCGCACGATTGCGCCGAGCGCCTCGGGCTCAAGCACGTGAGCGTTGGCGAAGGGCTCGAGCGCCACATCACGATCTCGCATAGATAGACAG
CAATGGATCTGTACCACGTCAAAGCGACTATTGTCGAGCCATCCATGCCTTCCGTGATTAAATATATGCACAGTAAATAGAATTCACAACCATACCATCC
ATGTCCACAGAACAGAGCCAACCACGTCACCATAATGGCAAAAGAGAAGCACAACATTGTTGATAACAAACCATTACCATCCTTCCTGCCTCTCTCTCTG
TCATTTCTTCCTCTTACATCATTCATGGTCTTGCTTCATTCTCGATGTCCACCGCCACCACACCCCATACTTACCGCAACTCCATTGCTTCCATACAAAG
CAGCGCAGCCACAGCAAACAGAGAGGAATAGCGGCGAGGCGGCAACATGCGAGTCGAGTCGACAACGTGTCTACGAAATCCTAGTCTTCTCTGTTTACTT
ACGGGCGGCTCTTCTGTCGGCGCGGGTTGCGGCGTGGAAACCCGAGCGGATTGCAGCCACGGAGCGCGAGGACCCACAGTCCTGGCAGTGCACGAAATAT
AAGCGACTGACGCTGTCGCGCGTGAGCGTCGTGTTCGGCGAGCGGCACATCTGGCACGACACGTACTCCGTAATGTACTTGCGCAGCAGACTCTCAATGT
ACTTTGGCACGTAGCGACCGCGAATCACAAGGCGCTGGTTGCCGTCGATCGAGCCTTCGGTACCGAGCTCCGAAAGCGTGAACTGGAGCACGTGCTCCGG
GCTACGGTGCATCATCTGGCAGATCTCCTGGAAGTTCACCCACAGCGTCTTCTTCGTGCCCACACGCATGAGTTGCGGCGGCTTCATCGTGTGACGTTTG
CGGTCCGTCAACTCTGGGTTGTTCTCATGCAGCTTCGACATGATGCGCGCCAAGAGCTCGTCCTTGTACGAGTACGTCGCGGGGTCCTGCACCAGCACGG
ACGACGAGCCGCTCACCTCGGCGCTCGCGCCAGTCTCCGCGGCTTCCTCGGCGTCACCTTCCTTCTTCTACAGAAGAGGGGAGGGCAACCAACAACATAC
ACATACATCCAAAGGTTCAATCATCCGGTCATGCACACACCCACAGTCGCATGATCAACCCAACCCAAACGTAGTGGATTCGTACACAAACGCACCTCTT
TCTTGACTTTCTTCTTCTTCTTCTTCTTGCTTAAGTCGAACATGGCGGCGACATCCTCTGGGGCGCCTGGCGGGGCGACCTCGCTGTCCACCGCCGACGT
GGTCTTCTTGGACTTTGGCACCTTTGGCACCGACGTGACTTCGACGTCCGACATGATCGCTTGTTTCGCTTTCTTCTTCCTGCTGGCTGCTGTTAGCTGC
TTGCTGTCGGCCCCCTGCTCTCGTGTTTGCTGGAGATGGCGGTGGTCGTTTGTTGCTGGTCCTGCGGAGCTTCTCGTTTCCACCCCTTTCCCCCTGCCCT
GAGCGAGCGGTGATCGCTTCACTTGCTTTCAGTATGTCTTTTCCAGACTATATAGCACGGTAGCCGATTTAGAGGAAGAGCCTTTCGTTCGCACGCTCTT
GGACTTTTCTGGTGGCTCTCGCTGAGCGACCCAAACATCCGAAAACCCATACACCCATCATCAGGTTAACCCAAGAACCCAAAAAGAAATCACAGGTCTT
CTAATGAGGCAAAGTACGGTTCTAGCAAAAGCAGAGCAGGGTTTTATTGAGAGCTCGGATTGTTGGTCAGCGAGGTTTTTCAACCATCAATTGGAAGGCG
GAGACCAGCCACGAAGAGCTTCCT