Description :
From Genome Similarity Track
Location :
Scaffold_5:154432- 158347
Transcript NameFunction/comments
Phyta_totarag404hypothetical protein PHYSODRAFT_494773
Phyta_totarag405hypothetical protein PHYSODRAFT_299326
Phyta_totarag406hypothetical protein PHYSODRAFT_299325
Phyta_totarag407vacuolar protein sorting-associated protein 8

Sequence
3915 bases(100 bases per row)
GAgatattgctgctggaagacctCCAGACGCAACGCGTAGCTCTGCAGGGCATGGACAGTAAGAAAAAATGGTTAAAAATGCGTTAGGTACATGCCTTTC
GACCATGAAGCAATGAATGGCTTACCTCGCGAATAAGCCTCACTTGGGtttccagcgcgcgctcTTCCTGTTTCTTTAGAAACTGGAGTTCATCCACCGC
TTGCTCCAGCATACTCTGAACCTGATTGGCAGCTAACAGACGTAGATAATAAATCCTCAGACAGAGCTACTAGTCCTGCTACTGTGACGTACTGGAGTCG
CGCTGCGCAGAATGCCGTTTCATCTGCTCCGCTAGCGCAGTCATATGCTGGTCAATTGCCGCTTGCAGCGGCCGCACATAATCCGTTGGCTCGCTGAGTC
TGTCCAGTGCTCTGTCGTCGGCTGCAatactgctgttgcttgaGATGCTTCCTTGTGGACGAGATAAGGAGTGACATTGCTCCGCCACACCAATACTTGT
CGATGACCTTCGTTCCAAGTGATACTTATCTCTACCAATCTGGTCGTGCTTCCGCCGGTGCTGTCGGCTATTTGTCTTTTTCTTTGCCTTCGTCGGACGA
TTGAGGAAGATGCGGCGCAAACGTTtgaacttctgctgcgcCTCATTCTTCCCGTGCAGTCCCAGCTCGAGACCGTCACTTGAAACATCACTGGCACTGT
CGCTGCTACTTTCGACGTCGCTTTctctgctgaagctgctttCACTACAACTACTACTGTAGTGTATGGTGTCGCGGTCCTCTCTTCTGTTGCTCCTCCT
TCCCGTCATGTTGGTGACAGCAACTCGAATTGTGTGTCCTTTCGAGGCAAGGAAACTGACGTCAGTTTTGTACCATATTATTGGtacacgttgaagttgc
cggATACCCTATCGTTCTTGCTGACGGCGGGTCCCAGCTTCTGCCTTACAATTCTAACGGTAAGCTTGGACTCTGAAGCTGCCTTCGTCGCTATGGGGTT
GGTGGGCACGTTCTTCATGTACgccaagctggtggtgctggcgatAGGTCAAATGGTGGTAAAGTTGCTCCGTATCGGAACTACCCGCTTTACTGTAGTG
ACTCAACGTCTACTGGGCACGCCTCGCATCGATCTACCGAATGGAGACCAACAGTTGCTGGGCACTGAGTGTGTCGACGACGCAGTGCAGAAGGACTTCG
CAGACGAATGGGTGTCCATGTCCGACGAGGACAAGTGGGAGTCTGGCGGACGGGATCTGCTCGATGAGAACGAAAAACGAAGCTGTGAAGTCTCTGGATC
AAGCACTGAAGACGAGCTGATCGAGTTgagcgacggagaagagAGGCCGACGCCAATCACCTCGCTCCACTCAGCAAAGCGAAGCAGATTTGACCATCCT
ACCTCGACTCCAACCAAATTGACCAGCCCAGACTCCACAATGATGCTTCTATAAGAGAAAATACCAAGTAAGGACAGATTGGCGATGGTAAAACTCAACA
ATGATGTAGTTGAAGGCTCCTGGTCAGCATCGGTCtattttcatccaatcacaGCCTTCGCCCTAAATGAACTTCGTGTCATTGCACAACTGACCCATGT
CTTCGCGTACCGATaagcgctcgctgttggCGTTTCTCATGGCCGCCATCGTGGCCATCGCGTGCATGTTAGTGCTGGTCATGCGAGTGCCGagtgttgc
agcagctccagccaaTTCTGACGACTTTAAACGCTTCGGAATCGGCGAAGTGttcgacgaagacgaggacgaagatgacgacgactggGATttcatggac
gacgacgccattCTCGGGCTCTCGGAGCGGCGGAACAGCGGAAATATGGCAGATATTGACGTGAACAACGAAATCTGCGTGGATTCATTGCCGGCGGAGC
GTGTGGACGACAATTATTGCGACTGCAAaaacggcagcgacgaacCGAACACGTCGGCGTGTTCCCAtgtgctgctgagctcggATAAGGCCCCATTCGG
TCGGCAATTCAACTGCAAAACAGACGACAAGCTGGTGTCGTTAGCCTTTGTGGGAGACGGAGTGTGCGACTGCTGTGATGGCAGTGATGAGGGTGAGAGC
GTGTGTGTTGACACGTGTGAGTCGGCGTGGCAGGGGAGACTGGGGACACTTCGAGAGAGACTGAAGGTGGTGCAACACGGGAGGAAGGTTCGTAAAGGGT
ACTTAGCTGAAGCTGTgaacaaggtgaagcagctgaaaGAAGACTTTGAACGACTTGCAGAAGCTTATCACACAGGTCAGCGTGCGTTCGAGGATTTGCA
ACGTCGGGCGCAACACAACCCAGAGCTGCGAGGACAACTGGAGCAGTCGTATGATGTGCTGCACAGAGTGCAATATATCACGTATGTCCAGAGTCGTGTC
GTTGATCAGAGCACTTTCTCGGATGCGTCCTGGAAGCCTGCTTTCGTGGAGCTTGTGGGTCGGTGTTTCTCGTACacggtggacgagaaggagttGAAGG
GTGGAACCCCCAACGTTATCCCCCGCAAGTACGATATGGTGTTGTGCCCATTCCAGAACGTCTCACAAACTGAGCCATCGTATCCAAAGTGGACGAAGGC
GGAACGTCAAACCAAGGTCGGAGTTACTGCGGCAGATGAAaacgaagaggaagaagaggttCCACGCCCCATCGACCTGGGTATCTGGAACGAATGGCAA
GATGCAGTTAACTTTGCGCGTGTACAGAGCTATAACCATGGTGAGCCCTGCGCTAATGGGCAGGAGCGCCAGACACGTGTGGAGCTCTCGTGTGGTACTA
CGAATCGTGTGCTGTCCGTGGAGGAGCGTGAAATGTGTGAGTACGAGATTCGTTTCGAGACTCCTGTTGCGTGTGAGGCaacggaggaagaagcaTTGCT
GGATGAAATCTCTCAGGTTGAACAGTTCCCCAAGGAactgccgcagcagcacaaaacTGAGGTAGAAAAAGTGGATCGTCAACCTGAAGGTCATGAGGAG
CTGTAGTGGACGATGTCGTTGATAGAATAGAACTATGATCGAGTTGAATTACTCTTGATATCATTACATGTACGCAGAAAAGGATTATCAATATCTACGG
GTATAGCGAGCATGGTCAGGGTTGAGCACGACTGCGATTGTCTCCGTCGACGGCTCTGAGCTCGATCTGCCAAAAATATGGCTACACTATGATAGCTACA
CTATGTTACATACCTCGTCATACCCTCTACAAGAACGTATCGACCAGCTCATCTCCCTCTACAAGGGCCCTCAATCAGGGGGGCTTCCGCAACAAAGAGA
ACTTGCGAGCTAAAGACTCAAGAGCTGCGTGAGGAAGGAACGCTTGCACGAACTCGGCTCTATCTCGACAACCAGCGCAGCTACACGCGTGCAGCTAGTC
TCATCTGGTAGTCCAGTCTGCTGCACATCTTTTGACCATGAGCGCTGTTgagagtttgctgctggagagcgacgaggaggacctGGGAGAGCTGGATCTG
TCGGCCAtcacgctggaggagatccTGCGTGAGGAGGAGATGGCTACCAAGTCCACAGAGGGCGGAGAGATCCATGACGCCGTTCATCAGGATGGAGATG
ACCTGTTCTTCTCGCCCGCCACCTTCACACTGAATATCGAGCCAGGACCTGGCATGGACGTGATCCCAGCGCCCAAGccggcggctgctgcttctactaC
CAAGACGGAGACTCACTTCCGCACTCCACTGGAGATCGCAGAGGCCAgagagaagcagctgctgagctgtGTGGGGGTGGAGCTCATCTCCCCTCTGCAA
GTGAAGAGACGACTGCGTGCTCATGCCAGATCCAAAGCTCTCCAGTCCAGACGAGAGGGACTTGTagccatgaagaagaaccagaggaagaagaaaatcg
cagaaggagctgcgg