Description :
From Genome Similarity Track
Location :
contig_31:154421- 155422
Transcript NameFunction/comments
g6066.t1hypothetical protein PHYSODRAFT_428243

Sequence
1001 bases(100 bases per row)
TCCATCATCGTGCGAGAAAACGCTTGGTGTTGAACCTCAGGTAGGAGGCTACCCCACAGCCACTTCGAGAAGAACCTGGCTCATTCTTCCGAAGCCCAAG
CAAAACTTGAAGATTGTGGCGCGTTTCATATTCGACATGTAAAAGGCTGCTCACCATATATGTACAAAATGACCGCAAATTGGAGTTATTTTGCTACGAA
TCAAGTACTTGTCAACACTGTTTATTTGGCTACTCGTGTGGAACGTGAATCTTCGATGCCGGCATTATCACGAACCGTAGCGCTAAATTTCTGCAAGACA
GGGCTTTCGTGCTCTTAAAAACAAACTATTCGCCTGGGTCCTGACCACTCTGCCTTCCACGTGATATATGTTGCTACGCTGGTAGTGAAACCCGAGATTT
TAACGTTAGACTCCAATTTGCTTGGATTAGGGATTTACAAGTCGGCAAGCCGTGGAGTTCTCCTTTGAAGCCCCATTGGCATACTGTGACGACTTGCGAA
GACAGATACCAACCAACATTGATGCAGAAGATTGACTCGGTGCTTAACGTTACATTTGGCTGGAAATGTGTACGAGCATCGCATGCGAGCACACAAATAA
ATTGACCTCCTCTACGTGGCTGTTTTTACCTTGCCACGGCGCTCTGCAACATTTCAAATGATCCCTACTATGCAGGAACAGAGAGCTCATGGAACGTCTT
GTATCGGTCGAGCTCTCGATTGGGGGTATCGGCTTCTGCGTAGGTGGCTCAAGTTACAAGTCGGTCATCGAGGAGGCAAGTATTCCGTTGAACGCCTATT
GGCGCTGGAGGAGTACACTAGAACCGTGTCCGCTGCTCGTGTGCTGTTCGTTTGCGTGTGCACTCCTTTACCCATAATATGCGTCTCCGTGGCACAAGAA
ATGCTGCCCCTGCAAGACCCCAGTGATGGTTCGTACGCAAACTACGGCTTCTGGGTCCGAACAGGCTTAGTCACAGGCGTGGTCGCTGCTGCTACAGCAG
C