Description :
From Genome Similarity Track
Location :
Scaffold_187:15440- 17259
Sequence
1819 bases(100 bases per row)
GTACATCTTCTGCAAAATCGGGTTGGCCACGCTCTCCACTTCCTTCTGCTTCGCCTCGTACTCCTCCTTCTCGGCCGACTGGTTCGCATCGAGCCAGTTG
ATGGTCTCCGTCACCTTGTCGTCGATCGCCTTCCTGTCATCCTCCGGAATCTGGTCCTTCAACTTCTCCTCGTTCAGCGTGTTGCGCAAGTTGTACGCGT
AATTCTCTAGCGCATTCTTCGCTTCAATGCGGATCTTGTTCGCCTCGTCCTCCGACTTGTATTTCTCGGCCTCCGACACCATACGATCAATGTCGGCCTG
CGACAGACGGCCCTTGTCGTTCGTGATCGTGATCTTGTTCTCCTTGCCCGTAGACTTCTCCACGGCCGACACGTTTAGAATACCGTTCGCATCAATGTCG
AACGTCACGTCGATCTGAGGCACGCCGCGAGGCATGGGCGGGATGCCATCCAAATTGAACTTGCCAAGCAGGTTGTTGTCGCGCGTCATCGAGCGCTCGC
CTTCAAACACCTGAATCAGCACGCCCGGCTGGTTGTCCGCATACGTTGAAAACGTCTGCGACTTCTTCGTCGGCACCGTCGTGTTGCGCGCAATCAGCGT
CGTCATCACACCGCCGGCCGTCTCCAGACCAAGCGAAAGCGGCGTCACGTCCAGCAGTAGCAGGTCCTGCAGCTTCTCCGACGAGTCATTGCCACTCAAA
ATAGCAGCCTGGACAGTCGCACCGTACGCGACAGCCTCGTCCGGGTTAATCGACTTGTTGGGCTCCTTGCCGTTGAAAAAGTCCGACAACAGCTGCTGCA
CCTTCGGGATACGCGTCGAACCGCCCACGAGCACCACCTCATGCACCTGACTCTTCGACAGCTTGGCGTCACGCAGCACCTTCTCCACCGGCTCCATCGT
CTTGCGGAAATAGTCGCCGCACATGTCCTCGAAACGTGCGCGCGTGATGGTCGAGTTGAAGTCGATGCCATCGAACAGAGAGTCAATCTCAATGTACGCC
TGTGCCGACGACGACAGCGTCCGCTTCGCACGCTCACACGCCGTGCGCAGACGACGGAGCGCGCGCTGGTTCTCCGTGATGTCCTTGCGGTGCTTGCGTT
TAAACTCCTGCGTGAAGTGGTCCACGAGGCGGTTGTCAAAGTCCTCTCCGCCCAAATGCGTGTCCCCTGCAGTCGCCTTCACCTCAAAGATGCCGTCCTC
AATGCTCAGCAGCGACACGTCGAAAGTGCCGCCACCCAGGTCAAAGATGAGCACATTGCGCTCGCCGCCCTTCTTGTCCAGACCGTAGGCGATGGCCGCA
GCCGTCGGCTCGTTAATGATACGGAGCACGTTGAGTCCAGCAATGGCCCCTGCATCCTTCGTCGCCTGCCGCTGCGAGTCGTTAAAGTAGGCCGGCACCG
TGATCACCGCGTTCTTCACTTCCTTGCCGATAAACGCCTCGGCCACTTCGCGCATCTTGATGAGCACCATGGACGAAATCTCCTCGGGCTGAAACGTCTT
CGACTCGCCCTTGAACTGCACCGTGATCTGCGGCTTGTCGCCAGCACCCGACGTCAGCTTGAACGGCCAGTGCTTCACGTCCGCCTGCACCACCGCGTCC
GAGAACTTGCGACCAATGAGGCGCTTCGCGTCAAACACCGTATTGTGCGCGTTCATCGCCACCTGGTTCTTCGCCGCGTCACCGATCAGACGCTCCGTGT
CCGTGAACGCCACGTACGACGGCGTCGTGCGGTTACCCTGGTCGTTCGCAATGATCTCCACGCGGTCGTTCTGCCACACGCCGACGCACGAGTACGTCGT
GCCGAGGTCAATACCGACC