Description :
From Genome Similarity Track
Location :
scaffold_6:154355- 155710
Transcript NameFunction/comments
Pl_112794hypothetical protein PHYSODRAFT_474636

Sequence
1355 bases(100 bases per row)
TTACAGGCCAGGGTACAAACCAATGAATCCTGGAGTCGGCTCGCCTTGAACTTCACCAAAGTACAGCATGAATGTCTGGCGCCACGTTTCCACCATCGCA
CGGTCAGCCATGAACTTCGGGAACTCGTCCACGTTCGCAGCAGCGATCTCCCACGGGTGGCTCGAACCGCTGTTGGGGGTTAAGTCCACACGCACATTCT
CGTTCACGACCGACTTCTGTACATCCTCCGAGATAGCCCAGTTTACAAAGAGCTTGGCGGCTGCAGGGTGCTTAGCCTTGTTCAGGATGGCGATACGTTG
GCCCCATGATAGATACTCGTTGCCACCGTCCGTCACGAACGTGACGTTGGGTGTACGTGCCAATGCCAATGGTCTTATTCTTTGCCGCCACGAGGTCGCT
GGGCGTGTTGGAACCGCGGCGGAACGTGACATTCTGGTTGGCGAGGTCCTCAACCCAGCTCCAACCATATTTCTCGACGTAGCGTTTGTACAGGAAGAGC
ACGGCATCGTCGTCATTTGGGTAAGATGAGGCGATCTTGCCAGCCCATTGTGAGTCCACGAGATCGGCCGGCGACTTGGGCGCCATGACTCCATTCAATG
CCGTCTCGTCGTACAGGAAGCTGAAGGTGAACATCATGTAGGCCATGTATGCGCCGGACTGGTCACGGAAACCATCGTAGACCTGCGAGAAGTTGGCAGG
TTTGTACTCGAGCAGCTTACCCTCTTGGGCCCAGCGAGGGAAGTCCTGCAGCGTTTGCAATGCTACGAGGTCGGACACCAGCGTGTCAGTCTCGAGCTGG
TTGTCGATGCGTACGTCGTGGTACTTGCTATAATCGACGATGAGTGTGAAATTGATTTCTGGGAACGCTTTGGCGAATGCGTTGTGCAGTGTGTCCTGCT
GCAACGAGAAGTCTCCACCGTGATACTTCATGACGAGGTTGCCTCCTTCGGCGATTGCGTCGGCGTAGAGCTCATCGACGGTTTTGGTCTCTTCCTGGAC
TGCGAGGGTGACGGACGCGAAAAGAGCACAAAATAAAGCGGTGAGATGGATGTAGAGCTTCACAGTTGTTGGAGGGGATTGGTAGTGGGGTGGTTGATCG
CCGGTAAATTGTAGAATGAGGAGTGAGCTTGTTGTTATACCAAACAGGCGATGGAGCAAGCAAGGTATTGATGAAGACGGTATCTTGACAAGATGATCGC
AAGGGACGTTTCTGAAGTGATGGACGGAGATGGGCTGATAACGCGGCACCACGCTTGCGTCAACTGTTTACATTTCAGGGCTCACGTCAATGGAGGTGTC
GCTTAAGATCGATTAGCAAAACTTGTTTGGAAATCGCTATCACGCTTTAAGGTTG