Description :
From Genome Similarity Track
Location :
Scaffold_2071:1543- 6118
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2071-snap-gene-0.6Ser/thr protein kinase
Pytiw_DAOMBR242034maker-piw_contig_2071-fgenesh-gene-0.360S ribosomal protein L6
Pytiw_DAOMBR242034maker-piw_contig_2071-fgenesh-gene-0.4RAN GTPase-activating protein 1

Sequence
4575 bases(100 bases per row)
CACCACCGACAGCGCCAGGCTCTTGGCTCTCGGAGGCGCAGATCCGCTCCATCATGTACCAACTCTTCTGTGGCCTCGCACACATGCACAAGCACGGCTT
CTTCCACCGCGACATCAAGCCCGACAACCTCCTGTGCCACGACGAGACGCTCAAGATCGCCGACCTGGGCCAGGCGCGCGAGATCCGCTCGCGTCCGCCG
TACACGGACTACGTGGCCACGCGCTGGTACCGGAGCCCCGAGCTTCTATTGCGCGCGACGACTTATAACAGCCCCATCGACTTGTGGGCTTGTGGTTGCA
TCATGGCCGAGCTCTTTCTCCAGGTGCCGCTCTTTCCAGGTACCTCTGAGGCCGACCAGATGTGCCGCATCTGCAAGGTGCTGGGCACACCCACCAAGGA
GAACTGGCCCGAGGGCATGACGATGGTCTCCCAGATGCAGTTCAAGTTCCCAAAGTGCGCGCCCGTGCCCTGGAGCCACGTGCTCCCAGGCTGCACGAGC
AAGGCGGGCGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGTACGACTCGAGCAGGCGCCCCACGGCCGCCCAGGCGCTGCAGCACCGCTACTTTGACCAGACGATTCCGAGGCCCATGCTCACAATAACAAC
CTCCTCTGAGGTAGCTGCGATGCCCCTCAAAGCGGACTTCAAGACGACCTCCTATGCGACTTTCTACGGAGGAGGTAAGAAGACCTCGGATGGAACCCCG
GAGCCCTCGGGAGGTCGCTGGACGCGCAAGGACACGGGCCTGGCGAGTGAGGCCGCCCTGGGCTCGTCTCGGAAGGCGAACGGCTCGCCTCCGACGTACG
ACTTGGCCAGTGGCAATGTATCAACTTCGTCATCGCGGCAGGCGTCCAAGCAGATTGTCGACAAGCTCTTTGAACACTCGCCCCGCGAGAGTGACTTTGT
CGCCGACGCCAAGCCGTCAAGTCGAGACTCGCGAGCAGCCCCCGGTCCACACGCAACCAAGCAACTCACGCGCAAGGCCAGTGGCGAAGACTACTACTCG
GCACGCAAGTTCAGTCCGTCGCCCGAGGAGCAGGACGAAGATAATGATGAAGCTGACGCGAATGACCGAGATGCTGGCAGTGGTGGCCCCAATCGGAGCA
GTGGACGGCGACCGCGGCCTCTTCGCAATCGCAGCGAGGACCACATGCTGCAAGACCTCCTTGACGAGTTCATAGCGTAGCTTTTCGCAAGTAAATCGGT
ATGCTACTGGCAACCAGTGGATCCAATAAGACAAACAAATGCTATGGAAGACAACCAAGAGATTGTTAAAGTTCAGCAGGTATTTTCCTTTTGGATTAAA
CGATCAGCAGCTCGCCTAGCGCTCGTGTAATGCCATGGTCGCCTAGAACTTGAGCGCGTGGGCGCGGTCGTTCTTGGTGAGCGAGAACTTGGCGTTCAGG
TACGCCTTGAGGAACGGCTCGGCCTCGATCGTCTTGATGAGAGCGGCGTCGACAGCCTTCTGGTCCTTCTTGCGCTGGTCTGGGATGACTGGGGCCTGGG
AGGGAAATCAAAGCACAGCACGGCGGTTAATACCATGTAGGGAGCTTTGTCACAAGCAGCGATCCCAAGCGCTGATAAGGTGAAGTGCCTCATTCTCTCT
CACGAGTGAGAGAAAGCGAGGACGACTTCGTTCACCATCAAGATCCCCCTTATAGTGCAAGACACTTTCAGGGAGGTCTTGAATAGCAAAGAGTGTACAG
TGACAAACGGGACGGCTGATGGTGGCGCTCAACGCAGGGTGATGAAACAGAGGAGGGGGCACTTACGGTGGCGGACTGGGCGAAGAACTGCTCCTCCTTG
GTCTTCTTGGACGAGACCTTCTCCTTGGCGAAGTACGCGTCGTCGATCTCTGGGAGCTTGACGGCGGCGATGTCAACCTTGGTGGACGTGGCAATCACGT
ACGCCTGGTTCACGCGACGGAGTGGGACACCGTTGACCTTGTACGGGCCTGTTGGAAGGAAAATAAGACAGAGATCATTGTCAGCAACCCTGTGGACAGC
TTGAGATTTTTGTGGTCGACAGCTACATCGCAGCTCGGAGATGAGTTCCTCAGCTCTCATAATCTTCATATTTCTTCGACAGGTGACCCCAGACAACGAC
CGCCCAGCCACCCTCCGAGGAGAATGTCCAGGCGACGGCGCACGATGAGCACTCGACTCTTTCCACAGTCCACGCGCAGACATGAGGCCATAAAGACCCC
AGTCCACATGTGTCCTTCTGTGGAAGAAGCCAACCGCCCGCCACGCATAGAGTCCGGGTTCGGTTGCCTCTCGATGTCAAGTTTGCATCATTGGAACCAC
TGAAGAGCGAGTGTGCTGCTGTTGGTGATTGGATGCATAAGACGTACCAGTGACGAGCAGGAGTCCCGACGCGAGCTGCTTAAGGAACACCACGCGCTTG
CCACGGAAGCGGCCGGAGAGCAGGATGAGCACCGAGCCCGGCACGATCGACTTGCGAAGCTTGGCGGTCTTGACCGAGTTGCGGAGCGTCTTGGCCGACG
GGAGCGGCTTCGGGATGTAGTCGGCAGGGTACCACTTCTTGGTCGACGGCTTGGACACCGACTTGACCTTCTTGTCGCCGCCCTTCTTGGCGAAGTTGCG
GCGGCCGTTCGAGCGCGCGAGGCTGTTGCGCGAGATCGCGTTGATGCCGCGCGCGAGAACGACGTTCTGACGCTTGGTCACGGTCTTCTTGGCGGCGGGC
TTCTTGGCGGCGGCTTTGGCTGGCATGATGCTATATATACCTGCTTGTAGACAGAGAGGTGGTCGTGAGTCTCTCAGTCACTCATATACGCAGGCAAGAG
CTTCTTCATCGTACCTGTTTGGGAAAAACTGATTGCTCGTAGTCACATGCGCATGGTCTCGCTGCCCAGCCAAGGAGCTCTTGACCACCCAATCAGCACC
AGTCACCACGGTTCAGATGGAACCGAGACCTGAACCGAGGTTCAGTCTAAAATCCGATAAAATCAAAAATGGACTTCACTTAATCTTTGTATGCTTATGT
GGTGTATGACTTTTTTGCCGCTTAACCGCAAAAACATACAAAAGCCAAGTCAAGTGATATACGATTATTATAGTATTATTTCGATCAGTTTGTGAGAATA
TCATTAATAATATAATATTAGAGGTCCTCACACTTGGATGCCAAGATCAAGTTTGGGTAATAATATTAGGGTCGACCTCAGAATAGCCACGCTGGCTCGG
GATCTCTCTTTGAAAGCGCGCATCAAAAATGCCAGTTTGGCTCGGACTTGCATGCATGTGATCTGCCACCAAGGATGGCGCGCTTCATTGCTGCGTTACG
ATTCTCTACTTCTACTGATTCACTCTGTCCCTACATGCTACTTCCTACTCTTACTCGACTCTCTCGTCCACACAAAACTGTTTATTCGCCGTCGCTCTCG
TCGTCGCCATCGTTCTCCTGAAGCGAGCCGAGCACGTTCTGCTTGCCCAGGCCCGCGAGAATGGCCTGCACTTCGCTCACGCCCTTGTCCGAAATCTGGT
TGCAGTCGAGCTCCAGACGCGCGAGGTGCTGCTTGGTCGGCACAAGCGCATTCACGACCGCGAGCGCGCCCTTGGCCGTGATCTCATTCCCGCACAGCGA
GAGCTCAACGAGCGCTGGGAAGCTCTCGCTGCCAACCTCGGTGCAGAATGCCTTGACGCCTGCAGACGTGATCTCGTTCTCGTCTAGTCGGAGTACCTGC
AGCTGCATCTGGGTCTTGAAGAGCGGCGCAATGGCCACGAGGCCGTCGTCTTCGAGCTCGTTGCCGGAAAAGTCGAGCTCCAGCAGCTGGATGTTGCTGC
GCGCGAGCGCCTTGAGCACCTTCTTGGCGCCTTCGCCGCCCAGCGACGCGTCGCGGAGCTTGAGGAAGCGCAGCTGCGTCTGCTTGCCCACGGCCTCGGC
GAGCTGGTCGGCGCCCTCGTCCTCGAACGAGCAGTCGCTCACGTCCAGCGACGTGAGGTTGCGCAGGTGCAAGTTGATGTTGCGCACAAGCGCCTCGCTG
GCCTCAAGGCCCGCACGCGCGCTCGCGAAGCGGAACTTGGTAAGCTTAGGCATGCGGTGCAGCACGTTCGCGACCGCGAGACAGCCGTCGTGGCCGCTCA
TGTTGTTGTAAAAGTGGAACTCCTCGAGCGTCGACTCCGCTTCACTCCCGTGTTGCAGGATGATCTCCTGGGCGATCACCCCGGCTGCGGCCGCAGAGAT
ACCGTTATTGCAGAACAGCAGACGACGCAGCGCCGGCTGGGGGATCAGCAGGTCAAAGCACGCGCGCACACCCTTTTCGCCCAGCGCGTTGTCGCTCAAG
TCGATCTCGTCCAGGACGTGGCCCCGGAGCGCGCTGCACATGATGGTGAGCACGCGCAGGGCTTCGTCTTCATGG