Description :
From Genome Similarity Track
Location :
Scaffold_285:15429- 20062
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_285-fgenesh-gene-0.3Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_285-snap-gene-0.18Nucleolar protein c7b

Sequence
4633 bases(100 bases per row)
ATGAACGGGCTCATCGCCGTGCTGCGCATGCTCAAGCTCGTGGATACGGGCTCGGGACTCTGCCTCTTCACGACGCAGTGGAAATGGCACCCGCACGCCC
ACGCCGAGGGCGTCGACGCGCTCGTGCAATCGCTGGCGCAGTTTGCGCGTGAGATTGACGGTGGAGGTGCGTGTGGAGGAGACTCAGGAAGAAAGAAGGT
GATGGAAGGGTACTAATCAAATGCTAATTGGCGTAGACGTCGTGCGTGTGCACTTTGATTCGCACGCGAGCCGTACCACGAACGGCAGTGCGCCGGCCAG
TGGTACAAACAACGGGAGTGTCACGCCCACACACGCGAAGGCCGCCCCCGAGGACGAGCGGCGGCCGAGTTCCGTCAGCAGCGATGTACGGTGTCTCTTC
CCCATCCAAAATATGGATCCTCCTCACTGACGGGCATTACGGCATTGTCAACGACTAGCGGTTTGATCCGATGAGCGGACCCTCGGTTCTCGAGATGCTC
TCGCACACGAACGGACCGATCCAGGGCGTGCTCTTCCACGATCGCGTCTCGGAAGCCACGAGCCAGCGGCTCCGCGAGTTTGTCGAGCTGGTCGTTGAGC
GGTTCCTGCAATTGTACCGGCAAGAGATTGACCAGCTTCAGCCGGCGACCGCCGCCCACCAGGCGGCGCTCACACCCGAGGAGGTACAGTTAGGTCTTTT
TGTGTGTGGTCTCTTATGTCGTTGCTGAGACTTTGGTCATGAAACAGACCGCGCAGCTGATCGCACCGTTCGCGTCCTTTGACGAGGTCTTCGAGACGGA
GCTCGTGACGACACTGTAGAAGACGAGTCGATGAAGTTGTAAGGGTAAACACAGTGCCGGTGAGGTTTGCGTGAAAGAAAACAACAAAGCAGCGTGTTGT
CGTGAGCAGTCAGCCAATACATATTAATACTTTGGTGGGCGACACGAAAATTCTCACTCGGGACTCGGATCAGTCGAGCACACTGCGCTTCTTCATCTCC
TGGTGGGTCGACGGATGCTTATCACTGTGGGTGAAACCCCAGACTTCGACGTGGACGCAGTTGAACTCCTGGCTCGGGACCAGCGGACGGGAGCTAAACG
TCTCGCACGGCCCCGTCGTGCCTCGGGACAAGTCTGCATCCTAAAGCCAGAAGAGATTAGATTGAAAGGCCATGTTTCCACCCAAAAAAACATGTCGACA
CGTACCAGGTACAAGCCAAAGCTGCCGCCGCCGCCCATCACGAGCGACTCGTCCGAGCACAGCATAAAGTAATTGTTCCGTCGACTCCATGGGTATTTGG
CAAAATGGACCCCGACGGAAGAAGGTGCTGGTGCTGACTCCTTAGAAGCACCGCCTGCGCGAGGGCTGAATGAGAAGAGAAAGGTTTCGCCATTGCCGAA
ATACTGCGTCGACTTGTGCCACTCGTCTGAGCCGTAGCCGCCAAACACATTGCCAAGATCGTCTTTCACGACAATCAGTGTGGGGCTTTGGTTCTTGGCA
AGTATGATCAGTGTGTGGAGCGACGAGCCGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCGGCAGAGCTGTGTCGTGATTGGTAGCGAATGG
TCGATAAACGCCACGTGCTCGGGCGTGAGAATATGCGAGTGCCCGAGTAGCTTGTGCTTGTAGTCGTCGGGCTTGAAAGTGAACGACGGTCTCCGGTTCA
CCCGTGGCGGCGACGGTGGCGCCGCGATCGGCGCGTGCGTAGTCGATGACGTGCCTCCCGATTCTTCTTCGGTCGAGGCGTCTTCATCGTCTTGCATGAG
GCGCCACATCTCGAGCCACTCGCCTCGTAGGTCGTCCACGCAGCTCGGTGCATTCTTCAAGAGCTCGTCCATTTTCGATTCCGTATCACAAAACACCCGC
GTGAACGAGGCTTCGTCGGGCCGCAGCGCGTGCCACAAGGCGTCAAATATCTGAAACATGACTAAAAAGAGTTTCAGAAAGTACGCCTCCTCGGCAAACA
GCTCCCAAAAGGGCTCGACCGAGAGCGCCACGATATTGATGGTCGGGTGCTCCGGCGCCGGTCTAATAACAGCACACATACATATTGTCAGAAAGATACG
AGGCCCGTCCCACTATCCCATAAATGGACCTACACGAGATGGAGCAAGCGGACCAGCGACTTGCAAATGGCCGACGCCACGAGCCCCGCATCAAACGAGC
TTTGCACGGTCGGCAGCGCGCGCGTGTAGAGCCGCTCCAGCAAGTTCCGATCATTCTTGACCATGTGTGCGACACAGCGCAGTAGTAGCACGCCGCCCTT
GTCAAAGTTGCCGAGAATCGTCGGGCGGTTAAAGCCGTGCTTTTGCCACGCGTCGACGATACGGCGGTCGCCATCGTCTGGGATATTGTTGAGTTCGGGA
ATGGCCACAGGTTGCCGTCGACTGCCTAGGCTGCTGCCACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCATTGGAGGTCGCCCCAGCCATGA
CCGCCGAATAGGAAGGTGGCGCCGAGGTACTGAGCGGGAGCACGCCTTCATACAATGATGGAGAGGATGCCCGGTGCTTGAGCGGCGACGCCATTGTCTT
GCGGACCACGGGGGACGGGATACGATCCAGCGTATGGTTGTTGTTACTCGGCGGCGAGTCACAGTGCGGCGACTCTCTTTTCTTGACGCTCTCGACAAAA
ATGTCGGAGATCTCGTCCAGATACTGGCGGTCCGAGAGGAAATTGACTTGGGGCTTCATCTTGTACAGCTGATACATGGACAGCAGTGCCTGCTTCTTCG
ACTCGAGCCGTTCGAGTGCGTCCGAGACGTGGACGCGCACGTCCTGGAAAATCACGTCGTGGTGCTTGATCATGCGCTCGACGACCTGCGCGCCGACCGC
GGCAAAGCGCACGTCGTGGTTTTGTGGGTGCGACATCTTGCGTCGCCCTCCGGCCGCAGTCGTCAGCGCCTCGCTCTTGAACGCGACCACAGGCGCGAGC
ATAAACGACGCGAGCATCAGGTCAATGCCATTGTGCTGCGCGTGTTCGGGCAGCTGCAAGAAGTGCAACACGCCAATCACTTTCTCCAGTACGTACTTGC
AGTGGACCGGTAGTTCTTGCACGAGCAGCGCAATGTTGCGGACGCTCGCTTCTTCGTCCTTGAGCCGTCCCGACGCGACAAACGCTTCATACTTTTCCGA
CGTCAATAACGACTCCGGTAGGTTCTTGAAAAAGTCGAGCAGCAGCGCGCCGGCGCCGTGGGCGTCCAAGTCTCCTGGCAGCGCACCCTCGCTTTCGACG
ACTTCACGCAACTGGCTCACCGTCACGCTCAGCACGGTCGTGCGAAACAACCGCGGCGTGTCAGGAAACTCGTACAGGATATCGATACAGTCTTGCACAA
TGTTGGGGATCGAGAGCACGGGATCGATGAGCGCAAAGCGACTGTGGTACGGATTCTTCGAGAGGTAGGCAATACTCACGCCAAAGACGTGCTGCCACGG
CTTGATACCCTTGTGGCGATGCGGAAACACGACCGCCGAGATCTCGACAAACTCGTCGTCCGGGACGGCGGCGGGGGTTTCGGCTTGTGGCGCGAGTTTG
TCGGCCGAGACCGAGACGTCCGAAGCGAGCGGCGACGTGGGCAGAGATGCGGGCAGCGGCGATGAGTCCCCCACTACAGTGGGGACGGCGGTCGCGTCAC
CATCAACTTTAGTAGCCTCTGAAGCTTGCGGGGCAATCGGAATCGTCGGCACTTCTCTTGGAGGCAGGGCCCGGAACGGCTCGTCATCGACCTTGAGGTT
GAACCGCAAGGCGCGGCAGTCGATGACCATCTGGAGAAACAGGTCGAGTCCCTCGGAGCAGCGCACGAGTGCCCAGTCCTCATAACTCGTGCGCACGACT
TGATCGCACGCCATCGAGAAAATGATCTAGAACGGGAGAACACAGTGTGAGAAGGATCGGTGGGTATCCTCAGGAATCGCAAGAGACCGACGGGCTCACC
ATGAGACTCGTCTCCATGGTCTGCTTATTGAGGGCCAGCTTCATCCAGCACAGTGCCTTGCCTGCATCCGTCTAGAGATCCATTCCGCCTCAGTCTCTTT
TGTTTTTCGTATCCATTTCCACGGAAACAAGCGTCCATACCTGCGACAGCGTCGCGGCCTGTTGAATCGCATTCACGAGCGACGGCTCGTCCAGCACGAG
CGAGCTCGTGTACAAAACGTTCCAGAGCGACACGGTGTGGTCGCTCTGGTGGCGAAGCCCGAGCTTCAAGCACGTCTCCAGCGCATTCCCTACGAGTCCC
ACGAAACGATCCACTCAGTGCCGCGTGAAGAATCGCCCGCGCCGATTACAAGCCCTCCTCACCAAACTCGTGGACACAGAGATCATCGTCCGTCAGCACA
CGCCGTGGCTTCTTCGGTGTCGACGCACCGGACGCGGGCGATGGCGACATCAGTTCCAGTTCGCCACTGCTAGTCGATCGGCCGTCCGCGGCCTGCATGA
CGTCGAGCGTTGCCTTCTTCAGTCGCGTCTGTAGACCATTAAAGCGATCAGTACCATCCCCTCGACGATGGCAAGCAATCGAGAGGCATCAGCTGCGTAC
GAGCGCATCGAATCGCTGCTTCAAGTGGTCGTC