Description :
From Genome Similarity Track
Location :
Scaffold_57:154289- 159598
Transcript NameFunction/comments
Phyci_8945Hypothetical protein
Phyci_8946ATP-binding Cassette (ABC) Superfamily

Sequence
5309 bases(100 bases per row)
CACGGAGCTGCTGACCACGTGTCTGTCCACCATCGTCGCCAACGACTACACGTACGCGCTGTGCGTCATGAACTCGGGCTTCTTCAAGGTGGACTCGTCT
CGCTTCGGCGCCGCCGCGTCCACCGCCATCGCCTCGCTCAGTAGTACGAGCGGCTCCACCGCCGTGGACTCGAGCGGCACGTGCAGCCTCATGTGCACCA
AGCCGGCCATGGCGGCCTCCAGCTCGTGCTGCTCCGCCGCCAGCACCGTGCTGAGCTGTCCGCAGTCGTCCAGCAACATCTCGTACTGCAAGGACGTGAT
CGAGGACACGGTGGCCGACAGCCAGCAGTGCGGCCTCTCGGCGCAGAACACGGCGCTCATCGCGTGCGTGGCCGCCATCGTCGCTCTGTTCGCGGCCGTC
ATGCTGGCCGCCAGGATCCACGCGCGCAGGCAGGCGACGCACGCGTCCCTGGCGGACGGAGAGGCCGCGCTCGAGTCCAGGTTCGCCGCGGCCGGCAGGG
CCACGTGGGCCGCCGCCCTCGCGGCCTGGAGACAGGTGACCAACCTCATCTGGAAGAACCTGGTCATCCGCCGCCGCAAGCCCGTGTCCTTCGTGTTCGA
GCTGCTGCTGCCGCCCGTGCTGACGCTCGCGCTCGTGTTCATCGCCAACCTGGACTCGATCTTCGGCACGGGGAACAAGTACTCGAGCTCGTCCGAGGCG
GCGTCGCTGTCCGGCACCATCCTGTGCACGGGCCTGGACTCGCTCCAGTACACGGACTACGGCAAGCTCAGCACCAACATGTCGACCTTCTACAGCAGCG
GCCAGAGCGTCATCGGGCTCTTCCTGCTCATCAGCTACATCAAGTTCGTGTCCACGACCACGACGACCATGGTGATTGAGAAGGAGACGCGGATCCGCGA
GGTCATGAAGATCATGGGGCTGTCCAACGTCACGCTGCTGAGCTCGTGGTGCCTCACGTCGGCCATCTTGGCCACGCCCCTGGCGTTCGTCATTGCAGCG
GAGCTCAAGTACGGACAGGTGTTCCCCATGACCGAGTACGCGACGCTGGTGTTTCTCTTCTGGGCGCTGAGCCTGTCGATCGTGAGCTTCAGCTACTTCA
TCACGCCGTTCTTCAACAAGTCCCGCGCGGCGTCGATCGCCTCCGTTCTCTTGTGGCTCGTGCTGTTCTTCCCGTTCTTCTCGGTCATGTCCAAGTCCAA
CTCGTCCAAGTATTGGGGAGCGCTCGCGCCCCCGACTGCCTTTGCGCTGGGTATTGATGATTTGGTGCGTCGCGCGCAGCTCGGAAGGGGGCTGGCATAT
GCCATTGGACTCATCGAATCTCCCATTACGGTCCCCTCGGCTTTTGCGATGAGCTGGTTCTTGATTCTCGACTCGCTCATTCTAGTCGCACTCGGCTGGT
ACTTCGACAACGTACTCCCACAAGAGTTTGGCGTGCGCAAACCGTGGAACTTCCTTTTCGTGAAGGAATACTGGCTACCCTCGAGTGCGGCCAAAACTGA
TAAGGAAGTGATGGTGTTGGAATCCCCCAGCACGGCTTCATCGCCGCAAACCAACTATTCGTTTGGGTCACCGCGGGGCATGCGTCTCCTGCACCAGGCT
TCGTCGGATGGATCGGTCGTGATGATGAAGGACCGACCTGGTCTCGTAGCGTCTGTTGAACCGGTCAACACTACACTTGCTGCGCAGGAACAAAAGGGGA
CGTGCCTTCAGATTCGCAGCCTTCGTAAGGAATTCCCGTCGGATGATGGCGAGGTGAAGGTAGCAGTTCACGGCTTGAATCTTACGCTGTACGCTGGACA
GATATCCGCGCTACTGGGCCACAATGGTGCAGGAAAGACAACCACAATTTCGATGCTGACAGGCCTTATCCCGCCTACGTCGGGTGATGCGACGCTCTAC
GGCCGTTCCGTCCGTGAAGACTTCAACGAGCTCCGCCAGATCATGGGCATTTGCCCGCAGCATGACGTGCTTTTCAACGAATTGACCGTGGAAGAGCACT
TGCTGCTGTTTGGAACTATGAAACATATTCCGTTGGTCGCTCTGAAGGAAGAAGTGGAGCGCATGATTAAAGAGGTGGGCCTGGTGGAGAAAAGGAAGGT
TGCCGCGAGAAACCTGTCGGGTGGCCAGAAGCGCAAGCTTAGCGTTGCGTTGGCGTTCATGGGAGACAGCAAGCTGGTCTTCTTGGATGAGCCCACGTCG
GGAATGGATCCCTACTCTCGTCGTTTCACCTGGAACTTGCTGCAACGGAACCGCGATGACCGTGTCATCGTGCTAACGACGCACTttatggacgaggctg
acattctgggcgataggattgccattatggctgacggccagctctgttgcgctggaagctcgctcttcttgaaaaaccgttatggtgccgggtacaattt
gactatgattaagGCGCCTGGGTGCGACGTCGAAGCTGTTGGCGCATTCTTGCGTAGCTTCGTCCCGGAGGCGAAATGCCTGAGCAACTTTGGCTCCGAG
GTCGTATTCCAGCTCCCATCAAAATCGTCGGGAGTGTTCTCGACGATGTTGCAGGTGCTTGACGATGAAATGCGTCGTCTGCGCGTCGTTCAATATGGCG
TGTCCGTGACGACGTTGGAAGAAGTGTTCTTGCGTATTTCGCACGACCGTGAAGAGGAAGCTGAATTGGGCGTTGCTGCTTGTGGAGTGGAGGCTGTGGA
CCAAATCCGTAAGACGTCGGCAACATCAGCAAATTCCCGTGACACGTTTACGGGCGCCATCTCATCCGAGGCGACTAACCGTGCAACACTGTGGAGCCAA
TACGCAGCGCTTCTGACAAAGCGTGTGCGGATTGCAAAAAGAGACAAGAAGAATCTTCTGAATGCCGTGTGCATTCCTCTGCTCTTCCTGATTATTCTGG
TTTCGCTTCCTGAGATCAAAGTGGCAAGTTTTATAACGACGAGTGATTATGCAACTGACCTTGCTTCATCGTCGCGACAGGGTAGATGTTCAAGCGCCAA
TTTCTCGTTGGTATCCGTTCCTAGCGCTTGCGACAGCTACAATTTCAACTACTGCGACCTCGGTGTGATCGACTGCAGCTCTTCGACTTGCTGCGACAAA
ACGAATGTTGAATCTCCTTACTACGCGTGCAACATGTGCGCTGGCACGTCATCATCTAACCCAGTCACTCCGTGCTACAACAAATACTGCCTCGACCGGG
ATGGCGCGAAGCTTCAGGCTACGTTGAACGCCTTCTTGACGTCGGTTGTGGTGATGCTGGCATTTGCCTTCGTTCCAGCTGCAATTGTGGCCTTCGTCGT
TCGAGAGAAGAATCCTATCCAAAACGCCAAGGGGTTGCAACTGATATGTGGTGCGAACGTGTCAGCTTACTGGCTGTCTACATGGACGCACGATATTGTC
ATCATGATGGTAACAGTCATCGCCGCCATGATCATTGTGCCTTTGTCGGATCGGACGCTGACAAGTTCAATGGAAGTGTGGGGAGTTGTATGCCTGGTCG
GTTCCCACGCTCTAGCAGTGATCCCAATGGCATACCTATTCAGCTTCAAGTTTAAGAAGCACGCAGTGGCGCAGACATCATTGCTGGTGTTTGCGCTTTG
CACCGGCGGGTTATTGAGTATTTTCTCGTTCCTATGCCGGCTCATCGACTTCGACCTGACCCCAAACAACTCCTCCGATAACTTGACGCTGTCGTCGCTC
GACCGAAACTATCTGCGATGGATTTTCCTTCTCTTCCCTGGCTACAGCCTGAACAATGGCATTTATGAGATTGCCACGCGAAAGTTGAGTCGTAGCTCGC
TGTATGGTAGCAACACGGAGACGGTTGCTCCGCCCTCGTTTTTCGGAGCCTGGGTTGGTCTCGGCACGGATTACACGTGCACTTCGTGTTGGGATGCTAC
AAGTGGTGAAAATTGCTGTGAGCGAAACGTTTTTGACCTTGATGTAGCTGGAGCTCCCGTTGCGTACGCAGTGGTGGAAATCGTGCTGTTCATGATTCTG
GTATTTGTGATTGAGAACCGCAGTTTACACTGGCGCTCAGAACAACGCCAGCAATGGCCGCGCAATGAGGACGATGATGTGGCCAAAGAGCGTCAAAAAG
TCGAACGCTCGTACCCCACCCAGAATGACAGCGTCTTTATCCGAAACCTGCGCCAGCAGTACGCTGACGGAGGCAAAGTTGCGCTGGATGACTTGTGCCT
TTCCATTTCAAAGggagaatgctttggctaccttggtatcaacggagccggcaaatctacgacaatgaaagtcttgacaggcgagattgctccgaccaac
ggcttcgtgacgctgggaggctacgacttgtctcgtgatcgcgataaagcgcgtcgagtggttgggtactgccctcaatttgattcattgcacgacttgc
taactgtggaagaacagcttgagttgtacgcacgtcttaagggtatcccgagcgaccgtgtcaagaaagctgtggagcaaaagatcgaggaagtgggtct
cactgagtaccgcactaaactgacgcgtggactgagtggaggcaacaagcgtaagctttcgaccgccatcgccttgattggttcccctagtattattttc
cttgatgaaccttcgactggagtcgatccgagctcgcgaaggaaaatgtgggacgtgatcgccagtgtctgcgctgccaaggaatcgtgtgtggtcctta
caacgcacagtatggaggaagttgaagcgctgtgcacgcgtgtgggaattttggtgagcggaaggctgaaatgcttgggcagtgtcgagcacctgaagCA
GAAATTTGGCCGAGGCTACATTGTGGAGGTGAAGCTGCGGGAGCCGAGCTCGTCCTCGGTGGGCCGGTTGCAGCTCGAGGTGTATCGTATCCTGGGCGGC
AACAAAGCTGGCATAACATCGGACGACGTCATTAGCTTGTGCTCATCTCTCGGGGTGCCGAACCGTGCGCCCGAGATCACGAACGGCGAGGGCAATGGCA
GCGTTCTTCACAGCTACCTCGAGACGGCAGGCATCATCCCTATGGACGTCTTCTGTGCGTGGTGGCACACGGAGAACCTGGGCTCAGCACTGCAAGAGTT
CTTCCAGGTCAAATTCTCGGGCAGCCAGCTGATCGAGCACCAAGGTGGACACTTCCGGTTCCAAGTTCCCAAGCGTGCTCTCCGACCGTATGCCATCTTC
GGGCTGCTCGAGGAGAGCAAGGAGCAACTGCACGTGAGTGAATACGGTGTGAGCGAGACGTCGTTGGAGCACATTTTCAACACGATGGCCGCCCAGCAAG
GAGAAGAGC