Description :
From Genome Similarity Track
Location :
Scaffold_73:15428- 17399
Sequence
1971 bases(100 bases per row)
AGGTCGCTATCGTTTGAAACAGCAGCGCGAGGATCGTCGCTGTCGTCCGTACGATAGTACAACACATCGTTGTGCAACTCATAACGATGTAGACGAGCGC
GTTGAGCTGGATCCAACGCCTTGAGCGACTTATCAGACGGGTCTGACAAGTGGGCAACAAGTCGACGGATGTCACTATCTGTCGCATACGCTCTTTTGAT
ATCGTCGAGAAGCGACGATACCGGCCTGCTTTCTCGTGTGATTGCCATCACACGGCTTTCCTTTGAGTCATTCGTATTCGACTCAAAGTCTGGGCGACGT
GAGAGCGCATCTGCAACCACGTTAAATCGTCCGGGTTTGTACTCAACGTCAAACTCGTACTCGGCAAAAAATGAAAGCCATCGGGCCATTCTTTGCGACA
AATGTGGCAACTTCACTGCGGTACGCAGCGAAGCGTGGTCAGTGTAAACGGTGAACCGTTTACCTCCAAGTAGATACACTCTAAATTTTGTTAGAGCGTA
CTTCATGGCAAGCAACTCCTTGTCATGAACCGGGTAATTGCGCTCAGCTGGTGCGACAGATAACAGACCACACGTTCTCGATCCGCGTCGTCGCGCTGCA
TGAGCGTGCATCCGATTGCAAAGTCGGATGCATCACAGACCACGTAGAATGGTCGCTCGTGATCAGCGATCGCGAGAACCGGAGCTTCCACGAGGCTGCG
TTTCACCTTGACGAATGCTCCTTGACATTCGTCGGACCACTTCCAATCGACATCTTTCTTCAGCAATGATGAAAGAGGCCAAATGATACCCGCATAGTTC
TGCGAGTACTTATGGAGATGCGTCGCAAGCCCGAGGAACTTGCGAAGGTCCTTTTGGCTTGTTGGGACAGGCCAATCGTTGATTGCCTTGATCTTTTCGG
GATCAGGGCGCACTCCGTTCTTGCCGACAAAGCAGCCAAGAACGGGGATCTCATCAACACCAAACATACACTTTTGTATGTTAGCGTACAACTTGTGCTT
CCGTATTGAGTCCAAAAGCTGTTGGAGGTGCCCTTTGTGCACTTCCACATCGGATGTAGCATCCAATGCACGACTGCGTATGAACACGTCGTCAAAGTAA
CTGGGTGCGAATTTTCGCACCGGACGCAATAGTTGCGTGACGCACCTATTGAACGTGGCGGGAGCATTTGTTAGCCCCTGTGGCATAACAAGCCACTCCC
ACAGCATCCCGCTCGGGGTACTAACTGCCGTGAAAGGAATATCCTTTTCACGCATCAAGATTTGATAGAACCCATCTCTCAAATCGATCGTACTAAAGAT
AGTACTACCTTGCATGTTGTCAACGATGACATCTTTGCGAGGTATCGGCGTTTGTGCCGGGATTGTTGCCGCATTCAACTTGTTGAATGCATGCACGATC
CTCCATCCTCCTGTGGTCTTTTTCACACAGAAGGTGGGAGTGCAGTGCGGAGAGTTCGACTTGCGCACTTGGCCCGCTTTACGACGAGCTTCAAAGAACT
CGTTGATCACCTTGACTTGCTCACGAGGCAGTGACTATTGCCTTGTGACGCAGTATTTTGTTCCTGGCTTGAGATCAATCTCATGCCGAACTCCTTTGTC
TGTCGGAAGACGACTAGGAACTTCTTCTGGGAATACGTCTTCGTATTCCTTCAATAGTCCGTAGAACGGACTGTTTTTTAGGGACTCCCATCCCTGAGCC
TGAAATCGTTCCTTCTTAGTTGATTCGTCGAGTACATCAGTGTCCATCACTGATGACGACGCAAGGAAACATTCATCGAGTGGGTGCCTCTGCACTGCCG
ATTCGGCATTGCTCGATTCCTGAGGATCAATGTAACAAATCTGCTCGAGAGTGCCTCGACGCAGCTCTTTCATGAACCGTTTTTGGTTCATGATTGGTAG
CGCTACTACTTCCGAAGTTTCCTTCGGAGGGCCTTCCAGCGCTATCTCGTGCATACGAGATCCATTTTCAT