Description :
From Genome Similarity Track
Location :
Scaffold_70:15426- 18150
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_70-fgenesh-gene-0.1P-type ATPase (P-ATPase) Superfamily

Sequence
2724 bases(100 bases per row)
ATGTGGCAGGACATCCGCGTCGGCGACTTGCTTATGCTGAAGGACGGCGACGAGGTTCCGGCTGATTGTGTTCTGCTCGCGACAAGTCGACCTGATGGAC
GGTGCTATGTGGAGACGATGAATTTGGATGGCGAGACGAATCTCAAAATCCGAAGCGTAGCGAAATCGACCAAGCACTTGCTGTCTGCTGATGAGATCTT
GGAAAAGTACAGGATACATATCGAATGCGACGCTCCAGGCAAGGATCTCTTCTACTTCGATGGTGTGCTGAAACTGGAGAAGGCGATCCCTGATGGCACA
GATGCCTCAACGGTTGACACGAGTCTGACGATGGACAATCTGATCTTGCGCGGCAGTGACAGCCGGAACAGTGAGTGGACGATCGGGCTCGTGATTTACA
CGGGCAAAGAGACCAAGATTGCGATGAACTCGGCGAATGTCCCGTTGAAGCGAAGCTTTGTGGAGAAGACGCTCGACACCATGTTTGTGTTGGTGCTGAT
GCTGCTGTTCGGTATTGCGATTGCCTGCACGCTGGGCAACAACAACTGGAATTTGGACCTGGACGACGGGTCAACGCCCTGGTACATAGGCGACAGCGAC
GAGAACGCCTACATATTCCTGAGTTACGTGATTCTGTTCAACAACTTGATCCCGCTGTCGATGTACGTCACGATGGAAGGTGTGCGTTTCGTGCACGCTC
GGTACATTGAGAACGACCTGGAGATGTACGACGAGTCGACGGACACCCCTGCTCAGGTGCGCAACAGTAACATCAACGAAGACCTTGGACAGATCCAGTA
CATTTTCTCCGACAAGACGGGCACATTGACGCGTAACGAGATGATCTTTGCCAAGTGCACGATCGCCGGTCTTCGATACAACGATGTCGAGATGGAACCG
CTGAAGGCTGCTCGGCCAGGCACGCGATTCAACGACTCCCGGCTGCTGGCTCGTTTGAACTCGAACCACTCGACGCGGAAGGAGATTCACGAGTTCTTGC
TGCTGCTGACGATTTGCAACACTGTCATCCCGGAGTACGAACCTTCTCCGGATGGGAGCGTGGACTCGACCGGGTCAGAAGAGCAGGTCAAGTACAACGC
CTCGTCTCCAGACGAACAGGCGCTGGTTCTGGCGGCGAGAGACCTCGATTACGTATTGACGTCGCGGGATGGGTCCATGTGCAACACCAAGATCCAAGGC
CAGCTGGTGACGTTCGAAATCCTGAACGTTCTCGAGTTCAACAGCGACCGGAAGCGCATGTCTGTGATCGTTCGACACCCAGATGGAAGCATCGTACTGT
ACTGCAAGGGAGCTGACGATGTGCTCTTCGACTTGCTTTCGAGCTCGCAGCCTCAGGGAGTGGCCCACGTCACTCGAGGACACTTGCAGGAGTATGCGTC
GGAAGGACTTCGAACGCTGACGACGGCGATGCGGAGGCTAACTCAGGAGCAGTACGACGAGTGGTACCAGCTGTACCGTCAGGCCGAGCTGTCAATGGAA
GGTCGCGCGGCCAAGATCGCCAAGGTGTCTGCGATTATCGAAGTGGAGCTGACGTTGCTCGGTGCCACCGCCATTGAAGACCGCTTGCAGGAGGGTGTTG
AGGAGAGCATCTGCGCGCTTCGGAAGGCTGGCATCAACTTTTGGGTTCTCACTGGTGACAAGAAGGAGACCGCGTTGAGCATCGGGATGTCGTCGCATGT
CATCGACGACAACATGGATGTCATCGTGCTGAGCCAGCGCGACAAGAGCGCGTTGCGTGGACGGCTAGAGGAGCTGTACGTGGAGTTGGTCGACGAGCGG
TGGGGCAACGTCGACGAGTACTCGTCGACGACTAAAGTGCTGTACGAGTCCGTCAAGCGCGCGGTTATCTATTTGTGGGAGATTGCTAAGCTGGCGATTA
TCGGGCGAGACCAAGAAGCCGAGGCGCGCAAGAAGCGCCGACGTGTGCAGCAACGACGTGAAGAGCTTGCTGACCGCGGAGAGGCCACGCCACCGTCGAG
TCCGCTGCGCTACAACGAAGTGTACCCGCCTAACCAGCGACCTGAGCACGACTCGGTTGACAGCTACGATCGCAACCTTTGCGATCGTGAGTTCGAGCCG
AAGAACATCACGTCGAGCGACGAGTTCAGCGACGAGGAGATTGATTTCGCGATGGTGATCGACGGCAAGACGCTCACGTTGTTGCTTGACGATGACATCA
AGTACTTGTTCCTGGCGGTCGCGACTCAGTGCAAGTCGGTCATCTGCTGTCGGTGCTCCCCGTCGCAGAAGGCAGCTGTCGTGAAGCTAGTCACGGAGCC
CACGCTCATGTTTTCTCCAGGCAACATCACTCTCGCGATTGGTGATGGTGCGAATGATGTGCCTATGATCCAGGCTGCGAACGTTGGCGTCGGTATCAGC
GGCAAGGAAGGACGTCAGGCTGTGTTGTCGAGTGACTACTCGATCGCCGAGTTCCGATACCTGAAGCGTCTGCTGCTCGTGCACGGGAACTACAGCTACA
AGCGCATCTCGAAGCTGATCCTGTTCTCGTTCATGAAGAACGTGGCTCTGTCGCTATCGAACTTCTTCCTGGCCATGGAGTCCATGTACAGCGGACTGTT
GATGTACCAGAGTATCTTCTTCACGCTGTACAACGCGCTGTTCACGACCATCCCGATTGTGTTCATCGCCATGTACAACCAAGACGTGTCACCGGCAGTG
CTCATGCAGTACCCTACGCTGTAT