Description :
From Genome Similarity Track
Location :
Scaffold_323:15424- 27103
Transcript NameFunction/comments
Phymu_g8597hypothetical protein PHYSODRAFT_323413
Phymu_g8598ATP-dependent protease hslV
Phymu_g8599cyclic AMP-dependent protein kinase-like protein regulatory subunit

Sequence
11679 bases(100 bases per row)
CTGGGAAACGAAGACggagcttcaacttggttCTCATAATTGGAGGCAATGCGTCCAATGTAAACTGCTAAATCGCCCAAAGCCACCAGGATAGTACCAT
TAAACACTGTGGAGGGTCCCAATCATACAAACGACAGACGCAGATATCTGCCGCTGTAGTTTGCATCGAGTAAAGCAGAAAGTCGAAAGAAGAGAACAGC
AATGTCAGCAATTGACGTTGGTAGAAAACAGCAAACGAGATCGTAAACACTAGAGTGCACAATAGAGCAATCAGAGCTCCCAGTAATTCCAGTAGCTCCA
TAAACCCAGTTTCTTTGCTCCGACAGTGTATAACATAACGAGTAGCCACGTTGGAAATGATTTTCGGGCCGATGTCCAATGAAATAAAGTGCTAGAAGAG
TCAAATGTATGCGGAAATTTGACAAACAGTAAATGCTGTACGGTATAGTTTCTGTTTCGATGAATCATTTGAAATCCACGCCGTCGAGATCCTCGGTTTG
TCTTCGGGCTCCTGTTTCAATTTGCACCGATAAATGACGCTTTCAACTATTGTTGTGGACTTCCTACGGCGCAATCGAAGTGCTTTTCGTCTCCTAAAAA
TGATTCTTCCGAGGAGAAAACGCAGTGACACCAACCCATTCCCGAGAGTTCAAAATCCCCGCGCATATTCTGGTACTCCGTGATGGTAAAAGTCGAACCT
CCGTCTACATTTCCAAACGTGATCCAGGAGAAAACGATCAAAGTGGAGATAATTGAAGCGATCAGGAGATACGTCACGGATTTAATCCCCAGCACATGTG
AGTCGACACATACGACATGGTGGCCAGTCGATCACCATTCGGACGGATCGGATATCTCCGAAATACATCCACAACATGACGGTAACCACACTGGTAATGG
TCGAAAAGAACCAAAAATCAAACGTTCTGATCGCTAGACGAAACGCAACGTGATAATACTGCCCAACCCCAACAGGGTCCATAAACTATGGCCAAAATCG
CATGAATTCGCTCCATAGATGCCTCAACCATCGGTAATATAGCATTGAGGCAGTAAGAGACAGCTGCGCAAAGCAACAATTCTCAGTACCAGTATTTGTA
GTATTTCTGACGGATGGATGCGTCGACTCTTGCTGGTAGTAGACGACTTCGAAAGACTTGGATAAGTCGACTACCGGCAGAGGGAGGAGGCACTAGTGAA
TATATAACGCTGCAActggtggtggccaacgAAGTCATTACTCCAAACCAACGCAAGCAAAGCAGATCAAGTTTTGTCAATTCTAATCTAACCTGCACTA
ATCCAAGCGTGTTCTATTTCTTGTTCGACTTGAACAGCGCATACATCAAGATTGCAGCCTGTGAAATGAAAAGGCATACAAATATGTTTAAAGATCATTA
ATAAAACGGTAGGATGGCGCAGGTGAATTCCAGTTTGTCCTACCGTTTGGCGTTGCAAGGAACCAACTGGTTTATGACGGAGGTCTTAGAACTGTTGGAT
TTAAAATCAACAACCTGGTTGAGATTTTAACTTGTTCGCCTTCCGTTAGCAAAAATGTTGTCATAGCAGACTGAGTCACAAGGAATAGTGACATTATTCA
CTCGAGAAGAGCCAAACCTCACCACTAAGCATGTGCAGGCACCGCAAAATGGACGCGAAACTTGAACATGTTCCGCATGAACGGAGTCAGTGCGTCCAGT
GTAACGATCCAGTGAGCCCAGAACCACCGCGAAAGCGACATCAAGCACTGCGATAATTTCCATTTAGACAAACTGCAGACACAAATACTTGTCGACGTGA
CTTGGAACGAGTAGAACGCGATATCAAACGAAGTGAAGAGCAGTTTTAGCAACTGGCAGTGATAAAGACAGCGAATGAACCTGTAAAAAGAATTGTAAAG
ATCAGCGAAACCCAATAAGTtttcagctccagctgctcatTTTCTTCCGAATTACAAAAAGCTTTGAGAAATATTCCATGAGAGAGGAAGAACTCCACCG
CCCCTACCAGGTAAATCACTTCCAGAAGCCAAGATGATAGGGACTCTCGCTGTGGGATTTTACGCAACAGAATATTATCCGCATTAAATCTTTGGGGGGA
TTTGATGAATATCAAGTGCTGAACGGTATCTGCTTGTCGTAAAGAAAGTTTTTTCGAGTCAATCCTCGTGGAATCTCACACCATGGAAACTTCTGGTCTT
TGCAGTTCTAACTTTAATTTACACCGATAAATGACACACTCAATAAGAGAAGACGCACTCTTCCGTGGTATTTGAAGGGTCTTGCGTCTTCGGAAAATGA
TGTTGACAGGAGGAGGCCCATCGACACCAATCCGTCCCCAATTACGTCTACCCCTGAGAGATGAAACCCTCCGTACTCGTTCTCGTATTTTACGACGGTA
AATGTTGGTCCTTCATCCACTCGCCCGAGTATTATCCAGATGAAAACAACCACAACCGACAACATCCCGAAAATTAAgatatacatgtacgtcaAATTGC
GGAGACCTAAAACGTGGGCGTCGATAAAAATGACGTGATGAAAGCCAAACCAGTCGTTAAGCGCGCGAATCCACCTCATATCAGACAAATGCATAGAGAT
AGTCATGACAATTATGCTTGTcacagtggagaagaaccaaAAGTCGAACGTTCGGACAACAAGACGCACGATATCGTAACGCAGGGTCGTCAGAGTCTGA
CTCAGACTGCCAAAGCCTGATGGCAACCACAATAAAACGGCTAAAGCTGCAAGAACTTGCCCCACTGGAGCCTGCACTATCACCACCACGAGATTTAAGC
AGTAAGATACCACCCCCCACGCCAAGATTTGCCGATGATACTTGAAATATCGACGCCTGATGTATGTGTGGAATCGTGACGGTAAAAGACGATCTCGGGA
GGATTTTGATAGATCCACAACTGGAAGATAATGGGCTGGCACCAGTGCGTATTCCAAATTGCTGGGTGTATCCCTCATTGTCAGAATGCTACcacaagct
gcgcgagtAAATGCTCAGTAAACTGAGATTCAGAGAGCTCGAAATAATCAAGCTATCCAAAGTTAGCTTCTGTCATCTTTTCCTTGGCGTCAGCATTTTC
TAAATCTTGGAGTACGGCATCCGCTAGCACCCAGCTATTGATAGCGTTTACTCGAAGTCCGTACAACGTCCCCACTCCATCTCCACTGTACACAACTCGA
CCAGCCTCACGACAATTCGCTGATCGATCAGTCGAACACGGCGAGAATGCCTTACGAACCTCGCCGCCCGTTTAAAAAGGCTCTAGTGATGCACCACAGA
ACGAGGTCAGCGGatccacgagcagcttccgaaAGACAGGGAACTCCAacttctccattttccacTCGTTCCACTCGTTTTGGTCTGTTGTGGAGACGAA
AACCAACAGTGACTCCTGCAGCCTCGCGCCCCCTTGTGGTTGCAGAGCAGCACGCGAGTGAGAACTCGCGTCAACATGACCCGAACGATGGCATCGTGTT
CCTTAACACTCCGATCGAGTTCGATTTGCGCTCGTgtttcttcaagaagcagaaatCGTGCAATACAACGGAAGGTCTCGAGCGCTCGGCGATCAGCCAA
AGATCCGCTAGTAGTCGTCGCAGTCAAACAAGCGCATTGACATCCATGGATACGTCGTACACAGGGGATTTACCGTTTCGAACATCTGCAGTCACGAGTT
CCAGTAATTTGTCCACCCAACAAACGAAAAAGCCACGGCGGAGACTGCGTGCAAGCGAAGAGCTCTGTATCGTGCTACCTCGGTCAACAAGTCGAGGACG
GACGAGATCACAGAAGTCTTGGTTCTTGGGGCCAGGATTCAttggacgagatccagcagaagGAACTTTTGTCGCCACAAAGGACAAATCTATGGACGCT
GTGCACGCCGAGATCTCTGTAACTGGTGATGATTACTTCATACGTGACGCTCAAAGTACAACCGGCACGTTCCTTTGCTTAAGTACCCGATACCGGCATT
ACCCGCAGCGAGATGGATTTCGTCTGCGTAGTGGGGACATCTTTCGCATTGGACCAGCTACTTCCATTCGCGTTGAGGACTTGCAAACCTCCATGAATCA
TAGTCCCCTTCGTCGTATCAAGTCTCGCTCTAGTTCAAGCTCAAATCTTGAACAACTTGGTGTAAAACCTGAAGTCACCAACACTCCAAAACTCGAGCGA
ATGCccagtaccagcagtggGACGTCAAAACCAGTGTTGAAGCCGATGTCAACCGTTGAGGAACTTCGTCTACTCGCTGCTGATATGGAGGACGAACTCC
TTCACAACAGACGCCCCTCAATTCCGCGAAGAAATAGTCTCGAACGGAAGCCACAACACCATGTCCACTTCTCCGATATACCACCAGTCATGTCCGATGG
CTCCATTTTCTTAGGTAGTCGTTATCTCCGACCGGACGTGAAAGACCTGCATTACCACGAGCCTTCCCAGGTAGAAGATGCCGACGATGACATAATCCAG
AAACTAGTTGGAAGCGACCACGATCCATCACCGACTGAATACTCCAGCTCACCAATCAAAACCCGTAAACCTGTATCGCTTCGCCTCGTTATTTTCCAGC
ACAATCCCGCCAACGTCAGCACAGAGCCTCTGCAGCCTCAAGATACTCGCGAAGTCATTTTACCAGGTCAACAGTCGTACCTTATAgggtcttcagcagc
gtgcGACGTGCGCATTTTCCCCTCCGAAGGCATTGAAATCCACGCTGTGCATGCTCGAATCGTCTTCGACGGTGTAGCCTTCATACTTCAGGATGTATCC
TTTGAGCGGGATCCACGCCGACAAACACGCGTTCTGCTGGCTCAAAGACCAGTGAAAATCACTCGAGGAGATTGGTTGCTGCTCGGTAAATGCGCGCTGT
ATGTCACAACGGTAGCCAGAGCTTTTGGCTCAGAACGCCGACCGGATATGAAGGAGGCAGCCATGCGTCTGGACGTTTTGCGTTTATCCAAGCGGAAACC
ACGGACGAAAGGCTTGTTTGTTCCTGTAGGCTTCCGGTTGCAGTCCGCCTCGGGTTCTGGAGCATCCAGCGGAAGTAGTGGGTGGGGTGGCAGCAGCGGT
GGGCCAGTTACATTCGGTAAAGGCCGAGACTGTGACGCTCAAGTCTTCACAGCGTCTTTAGCTACCGAACAATTCAGTGTCCAGCTCGAGCGGGGAACTT
GCCTCCTCACTCCTCGACTCACAGGTATCAACGCTGGTACGTATTTCCTAATCGGTCGCGACGAAGTTTACCCATCTCTTGAAGTTGACGCCGTGGATGA
CACCGAAGAACCGAGAGGAGTCGAAATTGTCAAGCACAGTAGTAAACCGTTGCTGCTCTCTGATGGGTGCGTGTTCCGGTGCGGTGGCAGTGAGATAGAG
GTCATTTGTGTAAAAAATACCAACGGCAGGAGCTCCTTGGAACAGCAGGAGCACGTCCGGTTTCTAAGTGCCATGTCGTGGCTAACACCAATCGCGACTG
ACTTGAAAATGGTCACTGTCGTCGCACGCTGCGGCCAGCGACTCCAGCTCAATGCGGGGGACTTGGTCTATGAGAAAGGGGACGCCGCAAACTTTGTCTT
TATCGTGATTCGCGGTGACGTAGATCTCATGGAAACCGAGCACGCTGAAGAGAGCCATGACATCGAGCAAGTGTCTCTGGGAGGATTCTTCGGAGAAGAA
AGCTTGTTTGACCCCTTGGAACAAAATTCTTCAACGCCACACACCGACGATCTGGAGTATACAAATACTGCGAAAGCAGCTACCGCTTGCGAACTGCTAG
CTTTGGCCAGAGAGGATATGTGCGGGTATCTTGAGCTGTACATGGACATTATCCGCGCTCACTTGAAACAGGATCGGTGTCGAGACAGGATTATCCGTTC
AGCATGCGGTTGTATTCCTTGGCTACAGGACATTTCTCTCCAAGAAATGCGCCTGCTTTCAGCCCACGCAGAAGTCACTGTGTATCCACCTGGATCGACC
TTATTTGAAGACGGGAAGCTGTTTATACCTGCTGCTTTTGCCAGTGGTAATACGTTTCAACTTCGGGATGGGCTCCTTGTGCTCCGTCGTGGGGATGCAC
GGGTTGTGAGAAGCAAACACGAGCGACAGCATCGACGAAACATGAAGATATATCATGCCAACTTTGAAGAGGAACATCGAGACATTGAAAGTGTCGATGA
TGAACCGGACGAGAGGTGGAGTCCCATGGAGCCAGTGGTCGCCATGAGCTCAAGGCTCTCTGAGTCGGTGCTGACTTTCAGCGATTTGTCATTCCGTGTT
GAAGCATGCTCCACAGTCGAGTGCTTCTTCATTGCCGCAGTTCATCTTGAACACTTGACAGCGTCCAAAGAAGAGAAAACTGCTGGTTCTGGGcctgaag
cagcaactgTCGCCCAGATTTCATCCCCTTTAAAACGAGGCAACTCACACATGGGAAGACGACTGCATCATTCAGAGGTAGTCACGAGCGCACTGCATAA
TGACGGTAATACctgtgacgacgaagattCCTCAATGGACGGGTCGGATGGAGAGGGAGATTCCACAGGAGCAcgtcgctggagacgcaagaagcgcaac
aaaCACCTACTGGAAGAAACGGTTCTAGAAACACAAAATGACGCGCAAATACCCAATGCGTTAGTCTTGTACGTACTGGCGGGGGCGCAACGGGGAGACA
TCCACGTTGTCCGTAATGTGGCATCCATCGGTGGGCTTCTTAGCGGGGCTGACATCGAACTCAATGACCGATATGTATCTCATTCGCATGCTATCATTGA
GTACCATGACGGCAAGTACTGGCTTTACGATAACGGCAGCAAATGGGGGACATTTGTGCGCCTGGAGGAAGACAACGCCGTCGATATCAATCCAGGAGAT
GTTTTCCTGGCCGGGGAGGTTGAATTCACTTGCCTCGCTGCGTACCCCGAACGCAATAAGCCCAGCTTGTGTTGTCTAATGTAACTAAACCCGCAAGAAA
ACTGTGAAAAAAAAGCGTGATTAGCAATAAAATGTAGGATAAACATCTCGGACATTCAGCTTTTCACCTAGTCAACATTCTTGCGTGGAGGGAGACGCAG
GTGGTCCTACGAGTATATGCGCCAGCACATCTGCCTGTGCGAATTCCTGGCCTGATCGGATGTCAACGCATACTGGGCCACCCAACGCCTGGAGTCCACC
CACAATGGGCAGAAACTCCATCCACACGGTCTTCATAGTCTTCGCTTCCATGACGTCCAGGTTCTACAGTAGTAAACTATAAATTAGCAACAATAAGCTT
CGAAACTTTGACACTAAACGGTACCTGGTGAGATGCTGACGAGCACACAATGCCGTGCATAAGTTCCTTGCGGAATTGAATTTGCAGCGCCACAGTTCGA
GTGGAATTGTTCGTCACAGATACAGCAGCCAAGAATGGTTGTCCAACAACCACATCCTTCGGCAGTTCGTCCACAGATATCGCGACTTCACTGAGCTGAC
CGGCATGACCAACCCCAGGgatcttcctcatcaccGGTTGACTTTGCACGGACCCAGCTTCGCCCATTGACGTTTTCCACCCCACGTGAAGTCGGCCGAG
ATTTTGTGATCCCTACAGCATACAAGGGTGAGCACAAAAGACGAAATGAAAATGGGAAATGTTCCATACCTGTGTCGATAGCAACGACGGGTCTGATGCC
GGATCATACGCCACTCGAAAGACgcgctgaagctcttcctgaGGGTACATAAGGGTCTGCGGCCCGTTGTTCGTCGACAATAACTCTTCAATCGAAgctt
gttctcctcgcttCTTAGCCGTGTTTTGTTTGTGCATCTCTTCCGATGTAAATGGAGGCAGTGGCAAAAACTTGATACTGTCCACAAACAGCGGCATTTT
GGACACATTTCGAACTTGAGCCTCCACAATAGCCTCtccctgttgctgctgtgatGCTACCGAGTGCTGCTTGAACGTAATCACCAGTGGATTCTGCACT
GCGAACCGGTAGAATTTCCGTAGCGACTTGTTCTCGCCAGTTACTGGATCCACATAGGCTACGCCTACACGCAGCACGTGGTTCCCGACTTGGTTCAGTG
GGTAATCCACTACCATATCCAGACTGGAgccagcagccagcactgcAACAGGATTGGGGGGAGGAAGCTTCCCTGTTCGAGCGTAGCGATTGTCGTGTAG
CTCCACACGGTCATTGGCACATTGGATATTGGCCGACAGTCCCACATCTCGTAATTCGCACGTGTACGGGTTAATGACGCTGATGTAGCTGCTGAATGTG
TTGCCTAGGAAGATCTCTCTAAGATGGAATaatattaaaaaaaaaaccaTTCCAATTGCTTACAAAAATAATATCATGGACGTACCCGAAGCTGTCCGGT
AGAATGAGCATACTAGAGAGCGCGAATTCATGTTGCGTAGCTGTGTCTTCGGCCATCGACGTGGGCAGCATAGAGCCCCCGCTGGCTCCTTGCACGTACA
GCTTGGGTTTGTAAAGCCGCATCACTAGAGAGAATATCATGATAAATAAGAGATTATTACATAGAGAGGGACAAGGATACAACACTACACCTTTAAGCGT
CGGTTGCACAGCCGGGGGAGACGGAGAGGACGTCGGTGGAGCGCCCCCACCGGAGGAAGGCGGCCCGCTAGTCGCGTACGCGGAGCTCATGATCCAGCAG
AGATGCTATAGTGCAATGTTGCGGCAAGAGCTGAGGATTAATGTTGCTCGCCTGCGCTTGCTCACTTGATCGACAATGTCGCGAGAAGGTTGCTTGTAGA
AGGCAAAGCTTGTGGTCAAGCTCATTTACAAGCTGAGGAAGATGCTGGCTCGCTCGCTGTTCCGCTCTGCCTCGAGCGCGCGCACGTCGCCGTCACTGGC
CGCCGCCTCGGCCAACTTCGGTGCCTCGCAGGTCGCGAACTTCTCTGAAGCGCCCAAGGTACGAATTCCGTCCGATTTACATGTAAAACTCGTATTTTAA
CTTGTTATTTTCGGTGTCGTAAATGATGGTAGATGCGCGGAACGACGATCCTGTGCGTCCGTAAGAACGGCAAAGTGGTGCGTTTAATGCTATATTTTAG
CTTTGTTACTACTACTGAGAAGGGGGCTCATTGTTGTTTTTTGTGTTGTCGTAGTGCCTCATCGGAGACGGCCAAGTGTCGCTGGGCAACACGGTAGTCA
AGcccaacgccaagaaggtgcGTCGCATCGGGGAGCACATCGTGGCGGGCTTTGCTGGATCCACGGCTGACGCCTTCACGCTCATGGAGCGTCTGGAGGC
CAAGCTAGACGAGTACCCTGGCCAGCTTACTCGCTCGtgcgtggagctggccaaggccTGGCGGACGGACAAGTACCTGCGTCATCTGGAAGCCCTCCTG
ATCGTCTCGGACCTCAAGCAGTCGTACACGCTCACGGGCAACGGAGACGTACTGGAACCCCATGACGGCATTATTGGCATCGGCTCGGGAGGCACCTACG
CTTTGGGTGCGTTTTGTTTGGGGAGATACTGTAAATGCAGGATAGAGATAACTAATTGGTGCCTTGTTACGTGGTGatgtagctgctgctcgtgctcttA
TTGACCAGGATCTGGACGCTGAAACGATCGCACGCAAGGCCATGAAGGTTGCCGCCGACATTTGCATCTACACGAACGAGAACTTtgtggtggagatgct
ggaggagggCAAGGACGACCTTATCGAGGAAAAGAAGGAATAAACGGCGTAGCATTTTTTGCATCAAGTTTTTCAGCAAGGTGGCGTGGAAGTATCACAA
TTCTGCAGCAAATGCCTGAAAGTAAATAAACGTGCAAAAGCTCAAACGAACTGTttgatctcgtcgtcaaGAAGATAATTCAGTTGAAGTGTGTGTAGTA
GATAAAGGATATTGTATGATAGTCATAGTCGGGCAGAGGAAGATAAAAGAACGCTAACAGTAGTCACAGAGGTAACTGCATCGACGCTACCCCGCCTGAT
AAATGGACGCGAGCGTGTCCGTTTGCAGTCCGGTGCTACTTGATCCTTTTGCCTCTTGCTTCTCGAAAATCGTGGTGGTTGGAAGGCGTGTATAAATGTA
TTGGTGCGCTTGTGCGCTTTCCTGTTCCTGTAGCTGCTTAAATGTTGTTGGCGATGACCGAGTTGTACTTGTCGATGTTGCGCTTCAGGATATCTTCTAG
CGGGCCCATAACCCGCTTGAACGTTTTACGGTCCAACGTGAGGCACTTGACCTTGCCCTTCGCTGTCACGGTTGCCTGGCGTGGTCGTGTTGTGAGTAAA
GCGATTTCACCGAAGTATGCACCTGAAGTGAGATCGCCCATTTCCACTGGCGGCTCAGCGGGTGAGAGCTGTTTCGTACACACTGCCGTGCCTTCCTCAA
TGATGTAAAACAGGTTGCCATCGTCACCCTGGGTGATGATGACTTCACCGTCACTAAACGTCTCCGTCTTGAGAGCATCTGCCACTGTGAGGCGTTCATA
CTCGCTCAGCGACTCGAGCAGCGGTACACGTTCAATGAAGCCCTTGTGCGCCTCGCGTTTCTTCAAAGTCGTCTCCATGATAATGAACTTAAATGTCTGT
CGATCCAATGCCCAAGCCTTCGAGTGTTGTACTGCCTTGACAGTTGCAGCACGCGGAGCGTTGTACATGAGCGCCAACTCCCCGAATGACATAGCCTCAG
TGCACTTTATTGGAAGcaacaaaaaaacaatcgTCAGAATGAAAATAACCAACAACAAAAAGCCACGACCAGTTTTCATCATGTAACGCACGGTTTGAac
aagctcgtcgtccttgtagACCTCACACACACCACTCTCAAGGATGTAGAAGTtatctccatcgtctcccTGCTTGATGATGATGTCACCGGGCTCGAAC
TCCTTGGGGAacatggcgtccagcacgatgtcgtgctgcttctcgtccagtgcCTTGAACAAAATATTCTCAACCACCATGCGGCTGATGCACTCCCTCT
CCTCAGCAGACTTGGGATGCACCACACGCTCGAACTGCCGTGCACTGCCGCGTCACATGCAAAAGAGCAAGTTAGCAGACAGGACGGGAAACTCCGCATA
TAGCATCACTTGTCATTCACAAACCTTAGGGGGTCGATGGTTTCAGCGGACACCGAAGTGCGCCGTCCCTTGGCCATGATCTTGGGTGGCGGTGCGCTGG
CAGCGATCTCCCCCACAGCGTCGCctccttcgtcctcgtcctcgctctcaCTCTCGTCCGAGTGatctagcagcagcaaaacggGAAGTGTTTTATCGTT
AGATCTCTCGTCTCTCTCCCAAACAACAAGCCAAAGAGTCGCGTACATTGCGCATGAGGTGACGCGGCGGGGTTGTCGTCCTTAGCGCCAGGCTTGCGGC
GCGGTGTGGCCTCCTCCGGGTAATTCGTCTGCAGGTACTGGATAATGTGTAGGATGGGGTTCTCTGGCTTGGCCAGTAGCAGCGACTCGACGAGGTTGAT
GAACAGCGTGTTGATGCCCTTCTTGTGCAGGTAgtcctgcagttcctgttgcACGCCCTCTGCGTCCGCCATGGTGTCTCTGCTGTCTGTCGGAGTAGTG
AGTGTGAgcgaatctgctgctggagaactAAACTGAGCGCCTGGCGTCACGGGCCTTCGCTCCAAAATGGAAGAAACCC