Description :
From Genome Similarity Track
Location :
Scaffold_333:15422- 17372
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_333-snap-gene-0.10RAB6 interacting protein 1
Pytiw_DAOMBR242034maker-piw_contig_333-fgenesh-gene-0.3Ran-binding protein 10

Sequence
1950 bases(100 bases per row)
CTGCGCGGCCCGACCCATCGCTCGTGCAGCCTCGCGAGCGCGAGCTCATTGAGCTACAGCATCAGGTGCGCATGCTCGCGAACCAGAACCACCGACTCAT
GGGCGAGCTCGTGAGCTCCCAGCGCGAAATGGGGCGTCTGCAGATGGAGCTCCAGCTCCAACAGCAGCCCCAGCTGCGCAAGATCAACAGCAGCGAGCAG
TGACAAACTCGCCATGAACTTATAAACAAAGAGCGAAATGATGGCATGTAGCCATTTTGCTTGAGAAGCACCATCAAAAAAGCATAAACACCCAACCACC
TGTCATATTTGATACCACTGAGATACCAAGTTTCAAGTTTGACTGGTACCCTGTCAGCGATCCCGATACATTATTTTCGCCATCTATGATCAATTATGAA
AGTATATCATTTTAATCAGGTATTAAATAAACCAGGTTTGCAGCTTTCCATTTTTTCAGTGCAAGCCATTCTCAAATCTCGCATATTTGAAAAAAGAACA
AGGGCCGCAAGATGGCGTTCGCCGAGCTGCCGGACGACCTGGTTGCGCGCGTGCTGGCGCTCGTGGCGCCGCGTGACCTGGAGGCCGTGACGGTGGCCAG
CAAGACCGTCTCGCAGCACGTGCTGCCACGCTTCCCGCTCTGGAAGGCGCTCTTCTGCTTCCGCTGGGCGCAGCTCAACTTCTCGCTCGAGGATGCGCAA
CGCCCCGGCGAGCACGCGGCCATCGAGATCGACCAGCGCGTGCGCGAGCTCTTGCCTAGGTATGGGGAGGGCTTGATAGTTGTATATGTGCTGCTATGGT
GTGCGTGTGCTGGTGTTGAATGACCGTTTGTTTGTTTGTTGGTTTGTTTGGTTGTAGCTCGGTGACGGAGAGCCGCATGTTCCAGTTGCTCGCCCACGCC
ATCACGCCCGTGCCGTCCTACGCAGACGTCAACGCCACGATGCGCTTCCGCCGCAACACGTGGATGGATCACACGTACGTACACACCACATTTGCTAATG
ATTCCAACTGTACCAGGAGCTATGTATCTAACTGCATTCATCTGATCGTATTTATTTATATTATACCCATGGACAACAGCGTCGTCGCGCTTGGTAGCGA
CGTCTTGGACTACAGACAGAGAGACAAACGCCGAACAAAAGTGCGGTCATTGGATTTCGCATTTGTGGGCCGCTATCTCGGCGGCGACCGCAGCGTGCGT
GCGAATGCGCCCTTCCCGACCACGTTCCACGTGCAGGTGCTCAAGGTGCGCGCACCCAATGGCGCGTGCTCATACAAAGTTGGTGTCACTGCGAGCGGAT
ACTTTGAGATCACAATCACGAAGCGTGAGCCACTACAGGGCGCGTACCGCGTGGCAGCGAGCGACATGACGGCTATTGGGATCGGCTCGAACAGCTTCCG
GCTCATTGGCAAACAGCCCGGGTGGGACGAGGACTCGTACGGCTACCACGGCGACGACGGCCACTATTTCCACCGCGCTGGCCATGGCCACGAGTTTGGA
CCGTCGTTCGACGTCGGCGACACGGTTGGCTGCGGCGTGCGGCGCAGCTTGCGCGAGCAGCGCTCGACGGTCTTCTTCACAAATAGCGGAGACCTGATTC
CAGGTGGGGAGCTGAGATTTTCTTTGACTGATGGGTGACAATGTCGTATGACTGAGGTTGTGGCTGTTGATTTTGCTGTAGATGGAGATGGAGGCATTGA
GTGCGAAAACGAAGATTGGTTCCCAGTGGTCGGCTTGGACTCGGCGAACGCCGTCCACGTCAACTACGGACAAGAGCCCTTCCGCTACGGCGCGATCGTT
GATGAGCTCTTCGACGAGTGCCGCGGGCAAACGAGCGTGCTGGTGAACCAGCTACAGTGGTACGACATTAGCGAGTCGGACGTCGAGTCGACCTGCGACG
AAGACGAAATGTCGGAGGGCAGCAGCGCATACCGTGAAGATGATGATGCT