Description :
From Genome Similarity Track
Location :
Scaffold_439:15420- 16693
Transcript NameFunction/comments
Phyke_g9497ABC transporter ABCA1 lipid exporter family

Sequence
1273 bases(100 bases per row)
GTCGATATGGATGTTGCCAAAGAAGCCCATCGAGTAGCTAACGGCGGCGCGGATAGTGATGCGGTAAAGCTTATGGGACTCCGCAAGGTCTACAATGGCG
GCAAAGTGGCGGTTCGCGACCTCTCGTTTGGTTTGAAGCGCGGCGAGTGCTTCGGCTTCCTCGGAATCAACGGCGCGGGAAAGACcacaacgatgaagat
gctgacgggAGATATTTCCCCGACCAGTGGTACGGCTACCCTCGGAGGTTTCGATATCTTATCGCAACAGATCGAAGTGCGCCGCCAGATTGGTTACTGT
CCTCAGTTCGACGCCCTGTTCGAACGAATGACTGTACGCGAACACTTGGAGCTTTTTGCCGCGATCAAGGGTGTGCAACGAGCTGACATGGATGCCGTGG
TGACTGAAAAGATCCAACAGCTGAACCTTGCCGACTTCGAGAACAAATTGGCCGGCAGCCTGAGTGGCGGCAACAAACGAAAGCTGTCAGTGGCCATCGC
GCTAATCGGCAGCCCGCCCATTATCTTCCTGGACGAGCCGTCTACCGGCATGGACCCTGTGTCGCGCCGCTTCATGTGGGATGTTATCGCAGACATTTCT
ACTCGCGGCAAGGAATCCACGATCGTGTTGACGACGCATAGTATGGAGGAGTGCGAAGCACTATGTTCGCGTGTCGGTATCATGGTTGGTGGTCGGCTTC
GCTGCCTAGGCAGCGTGCAGCACCTGAAATCTCGATTCGGCGACGGACTTGTGTTCGATGCGAAACTCAATACGCCTACGCCAGAAGATGTGGAGTATCT
GCTGCAACACGTGTTCAGTGATAGCAATGGCTACGTGACACCGATAGAGCTAGAAGACAAGTGCCGTGCCTTTGGCAACGCCGAATTGGCCAAGCGTATC
ACTGCGTCGCACCCTACTGGTTACAGTCTTGCTACCGCCATTGAGCGCGACGGGTTTATTCGTGCTGAAGCTTTTTGCTCTTGGTGCGTTGAGGAAAAGC
GGTTCGACGACTTGAATGACTACCTTGTCCAAGCGTTTGGCTCCAACGGCGTGGCTGTGCTAGAACGTCAGAACGACTTCTGCCGCTTCAAGGTGCGGGG
AGCTCAGGGTAGTGTCAAGCTGTCCAAGATGTTCTCTCTGGTTGAGGACGTGAGGGATAAAATGCACATTCGCGAGTACAGCGTTTCGCAGACGACGCTG
GAGCAGATTTTCAACTCGTTTGCTAGCCAACAGGACGAAGAGCAGGGTGTCGCCCGCGGTGTTTATCAGGGAT