Description :
From Genome Similarity Track
Location :
Scaffold_250:1542- 5260
Transcript NameFunction/comments
Phyke_g7219hypothetical protein

Sequence
3718 bases(100 bases per row)
GTTGAGATACGTTAGTTGCTTGGTTTGTTTCGTCGGTCGGTCGAGGAGCAGGCACTACTGCCGATTTACTTCATCGATCTAGAAGCAAGGCACATGCATA
GATTTATTTCCTACAGCTGCGATTGTGTGACTGAGATCGACGGGCAACAATAATCTTGGAGCTTATTTTCCGCTTGAAGATTTTACTTCGATGTTTCCCT
TCAACTTGATCCAACAGAACTTGGTCCTTTCTATCGTTAGTTTGCACAAATGCACCGATTTGATGCGCATCCATCATTGACACCGCGATGTGTGGAAGCC
TGTGCTGCATGTACCCGGAGGACTCTAACATTGGCATCCGATAACCTGTCGAGGTTGACGACTGCGTTGACACTGATGGTGAGCTTCTTCTACTAATACC
CATTGGTCAGAAATCATTTCTACCAATCCAATCGATCCATATCTTTCCTGAGAGGCATTCTCAGAAAGAAAAAGTTCAACCATGGAGGCGGATACGACGC
CCATGGACATCGACGCGGACGAGGAAGTCCCGCTGGCCGTCAGCACTGGGGCCAGTACCATCGAACCCGACGGCATCTCCGTCGAGTCTGTAGtggcaga
agcagctgcggAGCCTGTTTCGTCCCAGAGTGAAACCCAAAGACCTGAACCGGAAGCCTGGGGGactggagacgacgaggacggATGGATGCCCAAACCA
GCGCGTCTACACTCCGGCAAGACTCGGTCCTGCGCCGTATGTTTCGCACCACTGCAGTATACAGCGGCGACCAGTTGGGACGAATATCTGCAGAGCGAGG
AATATCTAGGTCAGCTGCAAGCCAACGTCCTGCAAGACGCCTTCGTATCAGCCTTAATCTGTGGAGAAAACACGGCTGGGGACCTCCCGACAGAACATCG
CATGCATAAAAACAGGAAGTTAAAATGTAGACAAAGTGTGCAGGACTATCGCAATATGACAAGCGCCGGAGTGGTGGACAAGTCTGGGATGGAGAAAGGA
TCCATTCGGACTTTAGAGGAGATGCTCATTGAAGCTCTACCGACTCCAGTGTTCACTCATGTGTTGGAGAGGAGACTGGCGGTGATTTCTCATAGTTCCA
AGATTGCTTGTGAGTTGATGAGGTGTGATGGGAAGAAGAAAATTCAGAGACCGGTGGAAACAGCTCCAGCTAATGAGGAGCTGCATCATTTGGCCATTCA
CACACTGTCGGCGCTCTTGGGGTCTTTTGATTACAGGAATCCGCAGGCATTGCAGTCATTTCAGGAACTATCACAGCTACTGACGTGCTTTCCAGTCTTG
TCGTTGTACTCATTTTGGAGCCCTGCGAAGAAGCCGCCGGATAAGGTACTTGCTTTGGATAAGGATGGAGTTGAAGCATCGTCAGTTACGACGAGCTCGG
ATTCGCATGGAGCTCATTGTGCAGTTGATGGGATTAGCAATACCTTCTGGCAATCGCAGCCTCGTCCAGGTGTTGTGAATCTTGCCATTCACTCTCTGGA
ATTAGTGAAGGTGACTTCTATTGCTATCCATTGGCATATGAAGTATGTCCCACAGAGTGTTGGAGTCCAGTATCGTGTAGACGGGAGCGAAAGCTTTGTG
CAACTGATCGAAGATATAGCGGTCTCTCCATCGGGCTCTACGCTCCTTACGACAAATTTTCCACCGTCTTGCCGAGAAGTGCGGATTGTGCTGTCGGGAA
CGTCGTCGTCCAATCGGAACGGAACGTATGCGATCGAACACTTGCGATTGAATGTACCAGCCCCAGGATCACTGTTTGCTGATCCTCAGTCAACTTTGAA
TGCAATCGCTCGTTGGCTTCTGGGAGCTTTTGATGCTAGTAATGAAGCCTTAGCTTCCGAAGCCATTGGGTCTCTGCGAGCTTGGGCACTGTCGACGGCG
TCACTTAATGTTACGATGTTGTTTGTGGATATGCTGTTACAGTATAATACTCGACCTGAAAATGTCAGGAGTCCAGACATAGCAGCGGTTGCTTTGCAAC
AAGGCCGTCTCTTATCGCAGGGGATAAATGCGTATCACACTGAAGAAGTTCAGCGGTTGGCACATGAGGGTGACAAAGTCGGATTTGGCGATGCTCGGag
agttgctgcagtttttgaaTCGTCAATTTGCTCGACAGGTgtgcttgtggaagatggCGGCATCGTTGTTCGGACGCGCGAAACAAGCTACCAGTACGCG
GCTGTGAGTTCTGGTATATCTTCTGGGAAAGCTTCGTGGAAATTTCGCCTGGATACAGATACACAGGATGATGAAATGACTTGCTTTGGTGCTGCGATTC
TTCCTGTGAATGTGAATGGCTATGACTCATCGCCTAGTTTATGGATGCTGCGAGGATATAATGGAAACCTGTATGCCCGTGGGCACAAGTTGAGCCGAAC
GATCGGTAAAGTGCACCCCGGTGATATTGTACAAGTTGACGTTGATATGAGTGAAGGCACGCTATCCTATAAAATTAACGGTACGGATTATGGTGTCGTG
TTCACGGATCTCGCAGGTCGTGAAGTGCACCCTGCTGTTTCGTTTTATGGATCGGGAAAAGTGATTACTCTCCTTGGTGTTAACAAGTGGGATTGCGCCG
GCTCTGGTCCAGCTGATATCGAACCTGCGTTCCTCTCGAGCATGAGAGAGTATCATTTTTCTGTTGGGTACGGGACCTTAGGGAAAGGAGGCCAGCTTGG
GTACGCAAGTGATGCAGACTCTCGTACTTCAACAGCAAACGCATCTAGTAATACGTCGATTCACATCAGTGGCAACGCAAAGCAGCGGTGTTTATCAACG
CATCCTCCGTCTCAAGGCGATGCCTACGTGATATACGATTTGTCGGAGGCTTATCGTACGATCATCGGCGCTGTCGCCATTAATGACGATACACGCAATG
AGATTCTCCAGCAACGTGGAGTCTCGTTGGTTTTCAAAATACTTGGAGACGGTGTGTTGTTGTGGCAATCAAAACCAATATCAGAAGTGCGCCAGGTTGA
AGAGTTTAATGTATCGGTGGAGAATGTCCGAATGTTGGAGCTGAAAGTTTCGTGCCCAGGATCAAACCAATGTGCACATGCAGTCTGGATTGATCCGTGC
CTATATCCTGTTGATGATTGGGCTTGCTCAAAgtgctccttcttcaacaAGGGGTCTTCAAATTTGTGCATAATTTGTCGAAGTGGTTCCCGAGAGGACA
AAGCACAAGTAGCCACGATCTCCGAGGAAACGGGTACCAAAACAAGTGTACCCGATGTATCGGTTCCACAGTTAGACTCCATGATTGAAGTTACGGGGTC
GCTCTGTGAGCTTGGCACAATAATCATCCGGCAAATTCATGATTTGTATGGACTCGAATCGAAGAATTCCAACACACTCGAAGTTAGCCAACATTCGTCC
ATATCACCCACGAATTTCATCCAGTTCGAGGAACCTTTTTGCCGTCAGCCAAGTCAGGGGGTGTTTACCTTGCTACTGTCTATTCTTCGACGATTTCGTG
CTCAATGCGTTGGTACTGAGGAAGACATGCATTCTGGAAACGATAAAAACCATATCCAAGATGGGTATGGGTACCTACTTGGGATTATCAGCGCTAATTT
GAAAAGCATTGAAAGTCATGACGTGAGAGATCCTGCAACAGAACTGGGTATTTCAGCCGAATTGGTAGCTGAACTCCGTGGGGAACTTGAAGCAGTGGCA
CATATTCGTGAAGAAAAT