Description :
From Genome Similarity Track
Location :
Scaffold_761:1541- 4549
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_761-snap-gene-0.5Major Facilitator Superfamily (MFS)
Pytve_DAOMBR484maker-pve_contig_761-fgenesh-gene-0.1Mitochondrial-processing peptidase subunit beta

Sequence
3008 bases(100 bases per row)
TGGAAGGAGGGACCGTTCACCAAGACCTATTGCGCCAAGAAAGCGGACGCCGAAGCCCGAGCCGCGACCCCCATGAGCATTCCTTATCTCATCTCGGCGA
GCATCTCGCCATTTCTGGGACTTTTGGTTGACCGCATTGGACGCAGAGCCATGCTGATCTTCTTCGCGCCGGTGGCGCTGGTTGTGGCGCACTTGCTGCT
GGCGGTGACCAGTGTGAACCCGTTTGTTCCCTTGACCTTGCTCGGCGTTGCGTACAGCTTCTTCGCCGCGGTGCTGTGGCCGGCCATCCCGCTCGTCGTG
GAAGAGCATCACGTTGGAACGGCGTACGGCGTCGTGACTGCAGCCATGGTGCGTTTATCTGTCTGATGTTTGCCATTGCTGGGTCGGGATCTGATGATGG
CTTTACTGGTTGTGCAATGCACAGAACACTGGACTCACGATCTTCCCACTCGTCGTGGCGACTCTGTACGAGGCCACTCGCTCGTACCTGTCGGACGTCG
CCTTCTTCTTCTGCGGTCTCGGTCTGGCCGGCTGTTTCGTTGGCGTGGCCATCAACGTGGTGGACTGGAGGAATGGCGGTGTGCTCAATACTCCCGAAGG
TCGATCAAGAGCGGACAAGACCGACGAATTGACGCCGCTCCTGTAGTGAGGGTGTTCAGCTTCCATGTCGGCATTTCGCTGCACAAGCAGTGCACTCATG
GCCAGGTGCTACGATAGAGCAAGCAGCGCCTGAAGATACTGCAATTGCTCTGATACGGGCATTTTGCCTCAACAAAGATCGCCGTCGTTTGGCTAGCCGT
GCACCACCAAAACCATGCAGCCATGAACGTTATTCTGTCCATCTCCTGCCAATACCAAAGTGACTCCCGAATAAATGCCGCCTTCTTCCCCAACACTTTT
GTAAGGTGAGCTCAACTCCGCATGCTCCAGTTTGTATACTCCATGCTTGGTGGGCGGCGAGCGTCTTTGTGCTCGTCAGTAATTTACTCGTCTCACCACA
GCCCACACTGGAGGACGTAAACTATCCTGTGACCCGTAATTTACGCGACCCGCCCGAACGTGCGGCGATGCCGGCGGTCCCCCCATTCGTGGCCTGGAAG
CGCAGCGCAGCCCCCACCCGCACTCAGTCGCCATGTTCTCCAAGCTCGTGCGCCAGCAGCCGCGCGCGCTCCTGTCGCGTGCGCAGTCGGTGTCGGCGGC
CGTGCAGAACTACCCGTCGTACGTGCTGAACGCGCCGGCCACCGAGGTGACGACGCTGCCGAATGGCCTGCGCGTGGCGTCCGAGGGTGCCCACGGCGAG
ACGGCGACGGTCGGCGTGTGGATCGGCGCGGGCTCCCGCTACGAGACGGCCGAGAACAACGGCGCCGCGCACTTCCTGGAGCACATGGCGTTCAAGGGCA
CGGCCAAGCGCACGCAGCAGCAGCTGGAGCTCGAGATCGAGAACATGGGCGGCCACCTGAACGCGTACACGAGCCGCGAGCAGACGGTGTACTACGCCAA
GGTGTTCAAGAAGGACGTGCCCCGCGCGCTGGACATCCTGAGCGACATCCTGCAGAACTCCAAGCTGGACGAGCAGGCCATCGAGCGCGAGCGCGACGTG
ATCCTGCGCGAGATGGAGGAGGTGAACAAGCAGTTCGAGGAGGTCATCTTCGACCGCCTGCACGAGACGGCGTACATGGGCAACGGCCTCGGCCGCACGA
TCCTCGGCCCCATTGAGAACGTGCGTGATGTTGTGAGGTATATCCGCTCTGGCTTTGTGCAACGGGACTAACGGTGTTGTTGTTGTCTTTTTCAGATCCG
CAACCTGAAGAAGGCCGACCTGGAGGACTACATCGCGACCCACTACACGGCGCCGCGCATGGTGGTTGCCGGCGCTGGCGCCGTGGACCACGCCCAGCTC
GTGGACCTGGCCAAGCAGTCGTTCGGCGACCTCCCGACGACCTCGAAGAAGGCGCCGACGTTCGAGCCCGCGCGCTTCGTGGGCTCGGACATCCGCATCA
AGGACGACGACCTGCCGCTCGCGCACGTGGCCATCTCGTTCGAGGGCTTCAGCTGGACGAGCGAGCACTCGTTCCCGCTGCTCGTGATGCAGACGCTGCT
GGGCAGCTGGGACCGCACGTCGAGCGCCGGCCTCAACATGTCGTCGAAGCTCGGCCAGGTGGTCGCGGAGAAGGAGCTCGCGCACTCGTTCATGGCGTTC
AACACGTGCTACCAGGACACGGGTCTCTTTGGCGTGTACGCGGTCGCGGACAAGTACAAGCTGAACGACCTGACGTGGTACACGATGGAGGCGCTCGTGC
GCCTGGTGCACAAGACCTCGGACGAAGAAGTGGAGCGCGCCAAGACCCAGCTCAAGGCCAACATGCTCATGCAGCTCGACGGCTCGTCGCCGATCTGCGA
GGACATTGGTCGCCAGCTGCTCACGTACGGCCGCCGCCTCACGCCGGCCGAGATCTTTGCTCGCATCGACGCCGTCGACGCCGCTGCCGTGCGCCAGACG
GCCGACGAGGTGATCAACGACAAGGAGCACGCGCTCGCGGCTATCGGCCCGATCTACGAGCTGCCGGACTACAACTTCATCCGCCGCCGCTCGTACTGGC
TCCGATACTAGGCGACTCGTCGAAGTCGACGGACGCCACCCCTTCCTGAGTGAGGCGTTGGATCGCGTGCACGATCGAGCCTACGCCGATAGAGGAGAGG
ATGGCCCGACGAGGTGTGCGTTCGCCCCTCCTGCTTTGAAATGAGGGGCGGAGCCAACGATCTGAGGTGGCGAAAGTAGCTGGCGGCGCGGGGTTGCATG
GAGAGAGAGAGCACGCGGGTAAATACACAAAACACACACGAGCTTTACCATATCAAGTGGCTGCATGCGTTTGAAACTTGTTCCTAATTGTCTGGATAAG
TGTTTTGTTCCAATGATCGTAGCATCGGGATATTACGCGAGACCAAATGGATGAGCATTCCAAACGTTCAAAATCACATCTGCGTGAAAGCCAAGGCGAA
AGCCAGCC