Description :
From Genome Similarity Track
Location :
Scaffold_90:154021- 155036
Sequence
1015 bases(100 bases per row)
CGCAAGCGCCTTCCAGTCACGAGAGAGGGATCATGGTACGGCTTAACTAAGCCAACGTAAAACACTGTGTGTGTTCGCAGCTTGCGCGGAAGATTTATAA
CATAGACAAGGCCTTTTTAAGCTATGACGGTGAACGGCCTAATGAAGTGCCGACGCAGCTTCGTCTTGAAGACGGCAGACACTACATTTGTAGGTAGGTT
TTTAGCATTTAGTATGACTTGGTCTCCAACTTTATAAGAATCGATACATCCTCTGCCCTTAGCATCAGCTTGTTCTGCTTGTATATCTTGGCTATCAGTC
ATTGCATCACGCACATGTCGTAAGACACTAAAGCGCGTCGCGAGAAACTCGCTCAATTGTTTCTGCATCGTGTTAGGGCTGATATCAGCAAGATTGTCCG
CAGAATCTTTTCACCAAGCCCAGGACCACATACTGGTAACGTGAGCGAAACTCGCGGGGGCGTGAGTCTATTCACATAGAAAGATGTAAAGCCGGTCGAT
GCATGAACAGCGTTGTTCAGCGCAAATGCGATGACAAGGAGCATCGAGATCTAAGTCTTGGACGACTCAGCACAAACACTGTATAGAACATCACCGATGA
CGCGATTAAATTGATCAGTTTGACCATTGTTCTGCGGATGATCTGCTGAGGACATGTCGAATCGTGTGCCAAGCATCTTGAAGATGGAAGTCCAAATCTT
TCCAGTAAAGCGAGGGTCGCGATCAGAGATGATTGCCTGCGTCAACCCGTGTTGACGAAACACACAATAGATAAACAGCATAGCCATAATGTTGCCATCG
ATGGGATCCGGCACCGCCGTTAAGTGAGCCATCTTACTTAAACGGTCGGCGAAGACCACAATTCCCGTATTGCCGTCACAGTCATTGGGAAGACCAAACA
CAAAATCCATACTGATGGACTCCCAACACCCCGTGGGCACAGGTAAACTGGCAAGCGGAGCAGCCCAATGTGCCGAGGGTTTGACCCGCTCGCACGTATC
GCATGTACGCACGTA