Description :
From Genome Similarity Track
Location :
contig_18:154005- 156639
Transcript NameFunction/comments
g4385.t1POM73980.1 Hypothetical protein PHPALM_9113, partial [Phytophthora palmivora var. palmivora

Sequence
2634 bases(100 bases per row)
CAGGAATCCAACGAGGATTTTTGTCGGTTGATAGGTAGTGTGGCAAAGGCTGATCAGGGTCGAGGTCGTGAATACGCATCATATACAACTGTACGAGCAC
GTCGACTTGAACAGGATGCTCTGCTTGACATGTTCGCTTGATCTCACCGATTTGCTTCAGCACAGACAACACATGAACCAAGTCGTCATGGCGATTAGCC
AACGGGAACTCTGGTGGTGGCTGGTTGGCACGAAGTGCTTTACGAGCTCGCTCTTCATACCACGCAGTTATTGCTGGCCACTTCTCAAGAACTCTCTCCA
ATGAACGCGTCATGCTCAGGAAACGTGAAGTAGAATATCCAACAAGTCGCGTGGAGGCACCCTGAGTCTTAGACTTACAGAGCTCTGCAAATAAGCTCCC
AGTGACAGACACGACCTTGACCTGAAATATTGTTCTTACCATCCGTGAGATTAAGTCCGCCATCTCCGGGTTAGCTGCAGCACTAGCAGCTCCATTTACA
CCACATGATGACTTTGTAGCTGCGTGGGCCATGTGTGCGAAGCACCACTCCCAGTGCAGATTGAGTTCTTTGCACAGCATCGATTTCACGTCACCCCCGA
GTCGCTCGTAGCCCCGTAGAAATCGCTCGTCGCTAAGCCAAAGTCCTCGAGCATGTGCTTCAACCACCCTTTGAAGGGCTTGACAATGCCGCCATCACGA
TCTCCATATGCGGGGTTGAACTTTCTCGTTCCCAAGAGAATGGACTTGTACTCCCAGGCCTTGTCCACCAGGTAAACCCGCAACCCAAGAAATTTGTCTT
GCGTTGTTTTGCAAGTCCAAAAATCTGCCACGAGCGTAAAGTTCGGGTAGTCCTCTCGGTTCTCTTGGAGGTAGTTAGTGATCTCCTTGCGTGTTGAAGA
ATACAGCTCCACGATAGATTCCTTCACCTGCTTTGTAGTTATCTTGGCCTTCATCTCGTCCTTATAGAGTAGCGCTTGGATTAGTCTTGCCTCTTCGTAC
TCCACCATACGAAACGTCAAGTTATGGTTGATGATCATGAGAGTGGTCATCAGCACGTTTAGCCGGGTTGGGTTGTTTGAGTACAGGGCGGACGATGACA
GGTGGTTGTAATCATGGTCGTGTTTGCGCTTCTTGACGGTCGCTATCTTTGTTTTCGGCGAGCCAACGTTGTGTATCTTCTGGAGGTGCTTCACGGCCAT
GGTCGTTTTGCCAGCATAGAGCTTGAACAGGTTTTTTCCTGACGTCCGACACGCCTCGTCGGCCAAACAAGCCCACGCGAAGACCTCCTTCTCGTTCTCG
ATGTACTTGACACGAACCCCCCACTTGAATATGTACGAAGTCTCCTTTGGTCGTGGAGGCACCAACTCGAAGGGTCCAAGGGCCTGGAACTCTTTCACTG
CTTGGAGGACCACAGAAGGTGGCTCTGTCATCGTCACGCGTTGGCTGGAGGTGTCGTGGGTCCCTGCAGATGTCACGAGTGTGAAGTAAGTCCCCGATGC
GGTCTCTAGTCTTGTCGGCTGCGCTGTGAGCTCGATGCTTGGCGGCGGAGCCTCTGACCTGAAGTCCGAGGACTAAAGCTGAGGCTGGAGGCACAGTGAG
TCCCTGCGGTGGCCACGAGTGTGGGTCACAGGTGGATTTAGTCCATGTACTGCTGCTTCAGGCGGAGTCCTCTGACCTTCTCCTGAAGTCCTTGACTTGA
TCCGTGTGCTGGAAGGTGCCGTGGTCCGTGTGGTGGTCACGAGCATAGACTTGCGGTGCTCAGGGTCCCTGGTGTGATCACGAGTCTGTCGGCTGCACTT
CGAGCGCGTCGGAGGCTCAGCACATGCGAACGCAGGCCGCTTCTTGGGCAGAGGATATCTTCGCGAGTGAGCTCGATAAATTTCAGTGCGGCTGTGGAAG
ATCGTGCGATTTTCAGCCAATCCAACGCGTAGGATACGAACACGCCAGATCCGCATAAATACGAAATGCGCGAGAACGAATATCGGGAGGGAAGCTCGCA
AAAATGTTCGTTGTTCTCGCACTTTAGCGAGGAGAACACGAAAATCACGTTTTTCATGTTCCCTCTTTTTCGTGGAAGCGTTTTTCACCTTTTTTTTTGT
TCCCCTACCCGCATGTTCGTCCAAGGCTTGCAAAAAACCGTCACGCCGGACTTGTGGCCAGTCGCACCTCATCATTTAAGTGCTCGACTTTTCAGTGTCC
GCCACAAGATTTGAGAACAAGCCGAAAACGTTGCGTTGGCATGGTTGCACACGCCAGTCTGGCCTCTTTCGACCGATCTGTCGCATATATCAACGTGTAG
TCTTGTCAAGTTGCGGCGTTGGATTCTTTTTTTTTTTGTCGTCGTAGGTAAATACTCGTGGCGTATTAACCTGGACCTCTTTTCGACTTAATGGCGCGTG
CCTCAGGTGAAACTCAACTAACTTCAATTTACCGCGGGGTACAGAAGAAAGGCTCAACTCGGAGCTGAACGACATTACGAGCCAAAAATTCCTGCAAGTA
TGCTGCAACTGAGGAGGCTCACGCACAATGAAACGAAAAAGATACGACCCGAAACACACAATCGATAGCTTGAAGTCTGCGCCTGTGGGGCACGTCTCAC
TCGGCATTTTGCCAGATTCAGCACAAGAAGCACT