Description :
From Genome Similarity Track
Location :
contig_18:154004- 156638
Transcript NameFunction/comments
g4596.t1hypothetical protein

Sequence
2634 bases(100 bases per row)
AAAGGCTGATCAGGGTCGAGGTCGTGAATACGCATCATATACAACTGTACGAGCACGTCGACTTGAACAGGATGCTCTGCTTGACATGTTCGCTTGATCT
CACCGATTTGCTTCAGCACAGACAACACATGAACCAAGTCGTCATGGCGATTAGCCAACGGGAACTCTGGTGGTGGCTGGTTGGCACGAAGTGCTTTACG
AGCTCGCTCTTCATACCACGCAGTTATTGCTGGCCACTTCTCAAGAACTCTCTCCAATGAACGCGTCATGCTCAGGAAACGTGAAGTAGAATATCCAACA
AGTCGCGTGGAGGCACCCTGAGTCTTAGACTTACAGAGCTCTGCAAATAAGCTCCCAGTGACAGACACGACCTTGACCTGAAATATTGTTCTTACCATCC
GTGAGATTAAGTCCGCCATCTCCGGGTTAGCTGCAGCACTAGCAGCTCCATTTACACCACATGATGACTTTGTAGCTGCGTGGGCCATGTGTGCGAAGCA
CCACTCCCAGTGCAGATTGAGTTCTTTGCACAGCATCGATTTCACGTCACCCCCGAGTCGCTCGTAGCCCCGTAGAAATCGCTCGTCGCTAAGCCAAAGT
CCTCGAGCATGTGCTTCAACCACCCTTTGAAGGGCTTGACAATGCCGCCATCACGATCTCCATATGCGGGGTTGAACTTTCTCGTTCCCAAGAGAATGGA
CTTGTACTCCCAGGCCTTGTCCACCAGGTAAACCCGCAACCCAAGAAATTTGTCTTGCGTTGTTTTGCAAGTCCAAAAATCTGCCACGAGCGTAAAGTTC
GGGTAGTCCTCTCGGTTCTCTTGGAGGTAGTTAGTGATCTCCTTGCGTGTTGAAGAATACAGCTCCACGATAGATTCCTTCACCTGCTTTGTAGTTATCT
TGGCCTTCATCTCGTCCTTATAGAGTAGCGCTTGGATTAGTCTTGCCTCTTCGTACTCCACCATACGAAACGTCAAGTTATGGTTGATGATCATGAGAGT
GGTCATCAGCACGTTTAGCCGGGTTGGGTTGTTTGAGTACAGGGCGGACGATGACAGGTGGTTGTAATCATGGTCGTGTTTGCGCTTCTTGACGGTCGCT
ATCTTTGTTTTCGGCGAGCCAACGTTGTGTATCTTCTGGAGGTGCTTCACGGCCATGGTCGTTTTGCCAGCATAGAGCTTGAACAGGTTTTTTCCTGACG
TCCGACACGCCTCGTCGGCCAAACAAGCCCACGCGAAGACCTCCTTCTCGTTCTCGATGTACTTGACACGAACCCCCCACTTGAATATGTACGAAGTCTC
CTTTGGTCGTGGAGGCACCAACTCGAAGGGTCCAAGGGCCTGGAACTCTTTCACTGCTTGGAGGACCACAGAAGGTGGCTCTGTCATCGTCACGCGTTGG
CTGGAGGTGTCGTGGGTCCCTGCAGATGTCACGAGTGTGAAGTAAGTCCCCGATGCGGTCTCTAGTCTTGTCGGCTGCGCTGTGAGCTCGATGCTTGGCG
GCGGAGCCTCTGACCTGAAGTCCGAGGACTAAAGCTGAGGCTGGAGGCACAGTGAGTCCCTGCGGTGGCCACGAGTGTGGGTCACAGGTGGATTTAGTCC
ATGTACTGCTGCTTCAGGCGGAGTCCTCTGACCTTCTCCTGAAGTCCTTGACTTGATCCGTGTGCTGGAAGGTGCCGTGGTCCGTGTGGTGGTCACGAGC
ATAGACTTGCGGTGCTCAGGGTCCCTGGTGTGATCACGAGTCTGTCGGCTGCACTTCGAGCGCGTCGGAGGCTCAGCACATGCGAACGCAGGCCGCTTCT
TGGGCAGAGGATATCTTCGCGAGTGAGCTCGATAAATTTCAGTGCGGCTGTGGAAGATCGTGCGATTTTCAGCCAATCCAACGCGTAGGATACGAACACG
CCAGATCCGCATAAATACGAAATGCGCGAGAACGAATATCGGGAGGGAAGCTCGCAAAAATGTTCGTTGTTCTCGCACTTTAGCGAGGAGAACACGAAAA
TCACGTTTTTCATGTTCCCTCTTTTTCGTGGAAGCGTTTTTCACCTTTTTTTTTGTTCCCCTACCCGCATGTTCGTCCAAGGCTTGCAAAAAACCGTCAC
GCCGGACTTGTGGCCAGTCGCACCTCATCATTTAAGTGCTCGACTTTTCAGTGTCCGCCACAAGATTTGAGAACAAGCCGAAAACGTTGCGTTGGCATGG
TTGCACACGCCAGTCTGGCCTCTTTCGACCGATCTGTCGCATATATCAACGTGTAGTCTTGTCAAGTTGCGGCGTTGGATTCTTTTTTTTTTTGTCGTCG
TAGGTAAATACTCGTGGCGTATTAACCTGGACCTCTTTTCGACTTAATGGCGCGTGCCTCAGGTGAAACTCAACTAACTTCAATTTACCGCGGGGTACAG
AAGAAAGGCTCAACTCGGAGCTGAACGACATTACGAGCCAAAAATTCCTGCAAGTATGCTGCAACTGAGGAGGCTCACGCACAATGAAACGAAAAAGATA
CGACCCGAAACACACAATCGATAGCTTGAAGTCTGCGCCTGTGGGGCACGTCTCACTCGGCATTTTGCCAGATTCAGCACAAGAAGCACTACACCCGCCA
AGACGGATGACATTCGACCACTCCGTCATTCCCC