Description :
From Genome Similarity Track
Location :
Scaffold_546:15400- 18078
Transcript NameFunction/comments
Phyag_g6527hypothetical protein
Phyag_g6528hypothetical protein

Sequence
2678 bases(100 bases per row)
TGGTGATCACTGCTTCCTTCCTGATCACGAGTGAGGCTCTCTCGGCGACCGCGGACTCCAAGCAGGCCAAGATCTCTACGGTGGCTGCGTTCGGTGGCCC
AAGCCAGCGATTTCTGACGACTCATTACCAGCCcgccgaagacgatgaaTCCGATGAGTCCGAAGACTCCGAAGAACGGGGTATCAACCTCACCTCAACC
CAACTCCAGGAACTTAAAGAATACCCTGCGACGTTAGGCATTAAGGCCCAAAAAGCACTGACCAAGCCAGAGTATCTGCGAAAGTTCTCACAAGAAAACA
TCGACCTGTATTGGGCAAAGCTCAACGCTTTgaaagcagcaaacacgaaGCACGGCCCTTCGATGATCGCGTACGAGAACATGGGGAAGTTCGTTAAATC
AGAATGATCGCGGCGAGAGTGGCGAACCCTGAACAAGCAACATGCGAATTCGTAGCGTTTGGAGATAGCACGCATTGTGAGTTCGTTACGCCTGAGTAGA
ACATTTGCCAGCGTGTTTGGTTCCTGTTGTTGAAATTGCGAAAGACCCAAAATCGTGACGCTTACTTCCAGTATTGACTACACATAAATGCAGAGCTTCT
TGCTTCGGTTTGCGGGTGCAGGTTCCAGTGTTCAACTTTGCCAATACCTGTACCATCGGATTCAGATAGCCTTCAAAGGTGCAATTACTTTTACGCAGTA
ATCCGCAAATTAATGGGAAACCCAATTTTTTTGTCTTCTTGGTTGTCTGGAGGAGAACAACAAGGTTCGACGTGACCTTGGACAAGCTCGGGAATGCCAA
AAGAAGTGCACTACAGCAATGCTATCGATAGACCAGCGCGATTGTCGGCGAACAAACTGCTCTTTATTTTCATTTTTGTGGAGCACTTGGTCGAAAACCA
AATAAATGAACTCCAGATGAATCGTCGGCCGAGTAATGCAAACGAAGCCGGTCAAGTCATTGGTGTTGGGCACGTCGGCAGTTGGTCTTCAAGGCAATGA
CGATTGTTAATTAGGTGAATTGCTCGACTTTTGGAGACTTCTTCCAGCAAAGTCGCAtcttctcttcatcacgGTAATCTATTTTACTAAACATTGTGAA
AATTTAAAAAAAATGCTGAAATTCTCGTTTCGAAATATCAAATATCGGCCTCGACTTTTATGTCACGGGTTCTTTTCGTCCAAAAATAATAGTCCAAAAT
GTCGGCAgccatcgagcagcgcaaccaGGACGCGACGGTGTATGTGGGGAATCTGGACGACCGCGTgagcgaggagctgctgtgggagctgatgctgcag
gcGGGCAGCGTGTGCAACGTGCACATGCCTCGGGACAAGATCACGGGCGCGCACCAGAATTACGGGTTCGTGGAGTTCCGCGCCGAGGAGTGCGCCGAGT
ACGCCGTGAAAGTTTTGAACATGATCCAGCTGTACGGCAAGGTGATTcgggtgaagaaggcgtccaacgacaagaagaacctgGACGTAGGCGCGAACCT
GTTTTTAGGCAATCTGGACCCGGAGGTGGatgagaagctgctgtacgacACATTCTCGGCCTTCGGAGGCATCATCGAGACGCCTAAAATCATGCGCGAC
CCGGAGAGTAAATCGTCGAGAGGGTTTGGATTCGTGAGCTTCGACTCGTTCGAGGCTGCCGACTTGGCTATCGAGTGCATGCACGGCCAGTATCTGTGCA
ATAGGCAagtggtggtgcagtacgCCTTCAAGAAGGACAGCCACAATGAACGGCACGGGTCGGAGGCCGAGCGGCTGTTGGCGCAGAGGAACCCCAACAA
GTTAAAGCCCCATACCATGTTTGCTTTTACGGCAGCTAATGGGGGAGTAGCTCCTGGAGggatgcagatgcaggcgccacctccaccgctgatgcagcaa
tttggtgctgctggacaagaagccgGAGGGTACATGGGGATGGGGATGGTgccacctccgccgccgccaccggCGATGGGGATGGCGTATCAAGCACctc
cgacgacgatgatggGGGtaccgccgccgccaccgccaccagcgCAGACGAGATGAATACAGGACGAGGTAGAACGGTTGGCTGGATGAGGTAGAAGGCT
GAGAGTAAATGTAGAATTTGCAGACGGTTGCAGACTGCGGCTCTTCGTGTTGGATCCTGTTCATTTCGACTTGTGCGCAATAGAGCAGACTGTTGactgc
gatggcgacgaaccAGGAGGAAGCTGTGCAAGGGGAGATGACTCGGCAGTATGTAGTTGCGGGTGTGACGCTGGATGGAGCGTTGAGGCCAGCAAAACGT
GGAGGCGCTACTTTGGTGCAGGTATCTTTTGTGCAGACTAACGTTGCTGTCCAGGAGGCTGACATGCGGAGCTTGGTATGGTTTACAGGTGGAAGAAACT
GGAGCGGTCTACTTGATCGGCGGCGCTAATCGAGAAGGCGTGAGCTTCGGCGACGTGCATCGTTTCGATTTGGGTGCGTTCACTGACGGCGACAAGGGTC
GACGAAAAGCGTTAACTTGTGTCGTGTTTCTCATGCAGGCACTCACAGATGGACACTAGTCAAGCCTTCAAGTGGTCGCCTACCTCCTAGAAGTGGACAC
TCTGCTATTGTGATTGGTGCCAGTATCTACGTTTTCGGTGGgctcgatgctgcagaaagTGAAATCTACAATGACATC