Description :
From Genome Similarity Track
Location :
Scaffold_930:1540- 12983
Transcript NameFunction/comments
Phyag_g8751hypothetical protein PHYSODRAFT_460566
Phyag_g8752hypothetical protein PHYSODRAFT_302913
Phyag_g8753hypothetical protein PHYSODRAFT_316562
Phyag_g8754conserved hypothetical protein
Phyag_g8755hypothetical protein PHYSODRAFT_354952

Sequence
11443 bases(100 bases per row)
GGTGGAGTTGTGCTTTGTGGCACTGTCGAGGATATTTGGGTGTCAGTCGGCAACGGGGTTGGTGGCTCCAGAGTTGCAAACAGTGTCATAGGTGTTGACA
ATGGTATCTTTGTAGATGTAGGCGCTTCGGATTCAATTGCTGGTGATAGTGTCTCGGTGGAATTTGGTGATCCCGGTGTAGCTGTCGGCACCGGTGTCTC
AATAGGTGTTGCTTCTCCTGCTAGCGCTGTGGGTACGGGGGTATCGGTTGACTTTGGTGCTTCGGTGGAGTGTGAGTGCGTCGGGGCTGCAGTGGTGTTT
gtgtcggtgctgttggccgCACAAATCATCTTCAGACCCGAGCACTGTTGATCTTCCAGTGGACATTCATCGACAGGAAGACGAGCGACGCAAAGCATCC
AGCAAACATCGGCTTGCGTGGTGGTTCCGGTGCAGTCACACTTCTTCTCGCACTTGGCATCGAAGAATTCAGTGTGGTAGTTGCAAGCTTGGTTGCAGCC
CACCGTCGGAGGTTTCTCCACACCAGGCTTCAGAGTGCAGATCGAATacgtgcagcttccttcaCTCTCCGCCAAGTGTCGCCCACCAGCACACCCGATT
GCTTTGAGGTCGTCGTTTGTGTCCCCATTGGCAAGTAAGTGGCGCGTTGTTCGGTTGGTGAACTCGTCAAAGTACAAGTTTGTCTTGAGCAGGCGTTGGT
ATGCAGGTAGCAGCGTCATCTTGCCGAACCACGCGCGAAGATTGCGCTGTcctggagcttcttcatcgtcccaGATCATTTCTTCAGGCATTCGCATGCC
GTGCATGACTGCAGGCAAGTGGTGACTAGTCTCGAGCCAACGCGACGCGCCGGTACCCATCATGATGACGAGTTCATCGGGTTTCAGCTCAGGACGCACG
ATTTCATCGAGTTCTGCATCTCCGATCACTAAGCCCGAGGCATCAGACTTCAGACGTCGCTCACGGATACTCCCGTCGTCACcgttgacggagaagaatT
TGGGCGCTGCCATCGCGATGAAGAGTCCATGGTCTTCGTGCATGGCCAATGACAAGTCTCGTTCAATTTCCTCGGCCGAAAGCGACCGGCGGCTTGGGCT
CGAGGGAGGTGGAACAGCTTCGTACGCGTGGAAATGGTCCAGACGCTTAGCATCCCCAACCAATTTCCGTGCACTGATGTGGCGTTCGCCGTCACCCATC
GTGAACTCGGTTTGATCGAGTGCTGAAGCGAACGTGTCCACTGCCCGCTCCAACGTACTGCTGAATTCTTCGTAAAGCTCTCGGTGACCCGGACAATTGG
CTGCCATTGAATTCAGCGTGTCAATGTCCGTCTCCATCAGCTCtcgtccggcagcagctcgcaacGTGAGGCGTCGAGTGCCGTCATGGAACTGCTTGGT
CGACAGGTAGCGCATTCCTTCGTCGGTCTGCTCGGAAGCAACGGCACATTGCACCGCACTAGCCAGGAACCGTTCGCGAGTGTTAATGTAGTTGGGGATG
TTTTTCAACGCGATGATGCCACCGCGTTCCAGGGCCTGGAGCATGCGCCTCGGTGCCTCATTTTCGTGCAATGAACCGTAGTCGAACGACGGAACCGCGA
AGCTTGGGACGTCCTCCAATGCACCATCAACGAGCCCGGCAGCGATTACAATGCACGCAAGTGCGAGTTTGAACCCGTGCAACatgacaagttgaagcgg
gTGGATCGGGGTGGTGGTTGTTTCTCGAGGAGACCAAAAGCGAAATGGCTGCGGGCACTGCTGAGCAACGGGAAGGAGAGCTGTAAATGTCATGCAATCA
ACCCATGGGTGTCAACGAGTGGCAGGAGCATGTCAACAACAATGATCGTCTTCGGCGGTGGGATAAATGGCTTCACCATCGCGGGAACGTTGCAGTGCCC
ACGACAATTGTTGATTGAgatgcacttcaacatgaatTCGATTGGATATCAGTGCTCATTTGTAGGAAACATCACTACCGACACAGGAGGGCATAAATAA
CAGTTTCCCACGTTGTTGAGTGTCTAACGAGCAGATTCTGGTGGGGGTAGACTTCGTGTTTGTACCTACCTTATCTCTTGAGTTATGGCCACCACCCTGA
CAAGTTTGAGAATAAAATATCTTTACCTCGTAGGATATCTTCTTGAGTAGCTCCAGTCAAGAAGAGAAGTTTCGCGTGAAGAGTCTTCAGAAGCAAAACT
GCTGATCTTTCATTGCAAGCTTAGTTCGTCAAATTCCGAGAGCAGCACTAACACCATGTCCAGCGAGAGTAAATCGAGTCCGGACtgcaaggacgagaag
actGGCGACAAGAACGTTGTGAGCGCATCCAGCGAAGCCAAAGCTCATGTCGGTCACGAAAAGGCGAGCGccaaagacgacgacgagagcaacTTCGATC
CAGAAAACAACGACCTAGTGAACAAGGTCATCTCCTTTTtcttcgacaacgacgagttcgCTCACACGTTCGAGACCTTCGCAGAGATGAATTGCCACGC
TTTTGATCTagacagcgacgagatgAAGCTCGAGTGAGTTGAAGAGCAGGCATAAGACAACGTATCACCAAACTAAAATTCTACGACTATTGTTTTTCGT
AGATACACGGACATCTACAACAAGTTCCTCGCTCTcttcgaggagaagctcgaagGTAAGCGCACTGATGCCTGCATTCGTGAAATGCAGCTAACAGGTG
ATGTTAACTTGTTTGCAGCCTACATCCAGTCACAGGGCGCCACCATTCAAGAATTTTATGAGCTGGTGCGTCGAGCGTACGAGGTCGACCGCCAGTCAGG
AACCGTACTCTGCTCGGAGATTCTGGTGGCGACGTGTGATTTTGACGTCTTTGTCTTAATGATGAGGCAAACCAAGGAGGCCGCGATGCTGGCTAAacgc
tgaagttgttgatcTCCATAAGGTTGGCAATTATTAGCGAAATCCACAATAAAGCGAAATTCATCGCTCCGCCATTGTTTGCCTTCGCAATCGCTCGACT
AGTGACGGCAGCTTCACCTttggtttcttcttcgtgttaCCAGTTGATGACCACGATACCATGTTTGCAGCTTTCTGGATTCCTTGTGAAATTTGAGATC
GGGAGTGGCTGTTCTGGTTGTTATTTGAGTTTCCATTCTGGGTTGGTTTGCGATTGAGTAGCTTCTGAACTCGATAGGTGGGGTCTTGCTGGCGTTGCCG
TTCTTCTTTAGTgtgttgctggcgctgcttcgcTCGTTTCATTTTATTCCACAGAGTCGCCGCCAGACTCTGCTCTTTGACAGGACTTTTAGGTTTTGGC
GTGCTAGGAGCTCTCACATTTGCAATGGGTTTGCAGATTTCTACGCTTCTGTCATCTTCCACGTCTTCTGCATCGTTGTTATCAacgcgttcttcttcga
gatcgATCCGCTGCGGATATTGTCTTTGGAGATGAGCCGCCGCAGGTGGGAGAACGGGGTCTTCCCAGCCGTCCACCAACTCCGGCGGAAGCTGGATGAG
ATCATCCAAATCTACTGCGTCATAAGGATCCCCGTCTTCATGTTTCCCTACCGCCTGTGCGAGTGCGAGTGCGTTTGCAAACTTTCGGCGCACATGAAAT
CCTCGAAATGTCGACTGTAAACGGAGTGCAGCCTCCTGGTTAGCAGGAGAACTGACAAATAATTcatcaacatcgtcgtcctcttcttcttgcggctgct
cttcatcatcactaaACTCTTCAAGGACAAGGGGAGaccccaccaccacaacctGCTGAAGTCGTCGCCGATGCCACATCTGAATCCGCTTTGCAGCGTC
ATCTACGGTCTCAGATCGTAGTCGATCCTTCTCAACGCATTGCGCGCACCAATTTTTCCATTGCTCTAGGCACTTTACCAACGCGTGCTGTCGGAAAACT
CGCTCGAGTCGTTGAAATGCTGTCGAGATATTGCTCAAAacttgcagtcgctgcatcTCATGTTGCATGTCGCGCTCCTTTGCTTCAGCCTCAGCCCGTT
GTCTCAAATAAACCCACGCACGCTGACAacgctcttcctcttgttccATGACAAAACGAAAACGTTCTTCCTTTTGTCTttgtacgagctgcagatgctc
aATGTAGTCCCATGCAGCCCGAGCCCGtcgttcttcctcctccataTAACAACGATAATGTTCCTCGCGCTGTCGCTCctcagcctgcagcttctgatTC
CTCTCAATGTTTTCACATATCCAGGCTAGTTCATCTTCACGAATCATCAAAGCACGATTCCTATCACATTCTCGTTGCTCAAGAAGAGCGCGGCACTCTG
CCACCACGCGTCGCATCCAGATCTCCTCACCTCGCATTTGTACACACTCCTCATGCTCACGCAGTGTTTGTTGGTCTCTAATCTGTCGCCGAATTTCGTG
GTGGTTTGTTAACTCCTCCAACACAGCGCCGAGACGGCTGCGAACCAAGTTTTTCTGTGTCTGGTAATTAGCTTGCCGCTCAACTTTCATTCGATGTCGT
TCGGCTTGGTCCTCGAGTGTCATTTGGACTATCTCGCTCTTGATTGCATTTTGTATCCGAGCCAACTCAGCCGCAAACTTTTTCGAGTTTTCGTCCGCGA
GGATCATAAGCAACGTTTCCTGAAATTcacgctctgcagcaacgaccGACCGACTAtgttcctcctcttcagtcATAAGGGATTGTTCCTGAGCCTCACG
ACGAGTAGCCTCTGCGTTCCTCTCTTGAGCTTCAAACTCTTCCTGTAGTcggagcagaagctgcgctgCATCATCGCGTTCCTTTTCGTATCTCGCATGA
GCCTTCAGACGACgaagttctcgagcttcCTGTTGTTTCGCGATGGCTCGAAGCTCTTTTTCAGCAGTTTTatcacgaagaagctgctttTCATCCATAG
GGTGAACGTCAGGCAAGGGTGAAGTCAGGGTAGACAGGTCACCCACCTCTAAAGGTGGTGGGATACGATCAACTGAAGTTGTGTCGACGATGGGTGGAGG
TTCACTGACAGCAAATTGTGTGAACGAGTTGACGATTACCAGGGAACTTGTAATAGCCACCTTCTCATCTTCAGTGTTGCTGAGTTCTTCATTGCAATCA
GCAACCTTGTCATAAACCCGTGCGTTCTCGTCAACACAAGCAATCTGCTCAATCTTGGAAGCCTCACAATCCAAATCCACCTTAATGTCCAATTGGTGCG
GTGGTACTTCGACTTCATGGATCTCTTGTTGCACATGTTGCTTTACGGGAGAGGTCGAAGACGTCACGTCCAGGATTGACGTACGAACTTCGTGTAAGAT
CCCTTGACATGGCTGGAAGAACTCTCGATCATTGCGTTCGAcgctttgcagcagcaactcccaACTGGTAGGTGCAACTCGCTGGCCTtcatcattgctg
ctggtgtcggtggTAGCCAAAGGCTGCAACCTGTTTAACGGAACTTGAgtcacctgctgcagcaccataTCGAGATCCAAGCGCACGTAGTCCATGTGGA
TTTCTCCATTACTAGTCGCCCAGCCGGCACTGTCGTCTTCCTGGTCATCAAAACTGTCGCCAAAGCCGACATCCTGAGCCGATAACGCTGCTAATTCCGC
TGCCAGCTCCCGAGCTAATGCTagtcgttcttcatcttcatcgtcgccctGGCTGGAAGCCGCCATCGATTATACACCGAATGCGACCTACAACTTTGGC
GATTGTCACAACTGGCTAATGCTCATTGCATTGAGCAAAAGAATGATGAAGTCCGGGGCGTGAGCCCCAGATGTGCTGTGGTGCTCTACCGCACCTCTAT
TTATATTGATTCGAGTTCTGCTTCATAAATATCTAGTGATTTTCAGCTATCACTTCTACTTCATctacaacttcttcatcgtcatctcccCCATCTTCGT
CTCGATCGCTGTAATCTGTAGCATCACCGACCGTAGCCACGAAGCCTTCCCGAGAACACAATGCAATCGTAATGGCGTGAAATCCGTCGCACGTGATGAA
GTTTTCCTGAAGCTTGAGCGTTTGCAGTCCAGCAAGTCCCAACACAGTGAACTGTTCGTGCTCTCGCTCGCCTGCCTTCTCCACGCCGTCGCAAACGCTC
AAGTCTGTCACAGGATCATCGAGCAAATCCGCAAGTGCAAATGCGTCCGTGTCGGTGAGGATGTTGCGACTGAGGTCAACCATCTGCAGCTCGCTGAAGG
gctcgacggcttcgagtaGCGCGCGGCAACCGGTTTCGCCCATGAAGTTGTTGCGCACAGTGAGCGTCTGCAGGTGTTCGAAGAACGTGTCGCGATTTTC
AAACAACTTGGCGAGTTGTCCAACACCTTTATCGCCGAGGAAAGTTGCGTCAAGCACCAaatggtgcagtggcttccTCACCGTCTTCGCATCAGCCAGT
GCTCTTAGCACCATTAGAACAGCGTCACTCTCTGATGCAAAGTCGAATGgggcgaggagctccagcCTCTGCAGCGAGGGACACGCTCCCTCTTCCAACG
CGTTAGCCACCTCACGAACCAATTGATGACCGAACGACGCGGTTGCGAGCGACGCCATGTGCGTGGACGCTGTAAGCGCTCGGGGGAACACAACTCCGGC
CTTGAGGTGATTCTGGTTATCTTGGTTGGAGATCGTGAGGCTGACGAGGTTCTTGCATtcatgcagcaacgtgcaCAGCCCActagcagctccgtcacct
cTGTTGCGAGTCTCCGTAGCTGGAAGAGCCAACGCCGCGTCGATATGCAGCGACCGCACGAACGATGGCGCGTGCAGATACAGAAACTTGTTGACAGCGC
GACACCGCAGCACGTCCTTGCCGTCCAGAAAGCTGCAGACCTGGTGCAGcaagtccaagttgctgttgagcACGCAGCCTCGTgcgccgacgctgcagtt
ccgGACCTCGTCTTCGGTGATAGTCAAACGGGGTCGCAGTCGTTtggctgctgaagctcgaATCGACGCCATGACGGCCTCACTCGGGTCGGTGTCGttg
cgcttgcgcttgtAGTGGGTCACGAGGCCCTGCACGCGTCGTTCGAGTGACGGTTGGTGCAGATACTCGCCCAAAGAACCCGCCGAATGGTAGAGCATCC
ACTCGAGtctttgcagcagcgacggactCGGGCTCGTGTCCTCTCGAGTCTGCAGAATTGGATGGTGCTGTGCTAGTGCCGGGTGGCTGCGGAGACGCGC
CATCATGATCTTGCGAACTTGGACGTCGGTGGGATCGtgccaagctgcagtggtggcgaATGCATTTGCGTCCTCGGGCGTAGTGGAGACCATCGGAGGT
TACTGCTacgctggacgagttggttTGGTTTAGTCGACTTTTTTGCGTAGAGACTTGGGCAGGAGTCGGCCAGTTGTGAAATGATCAGCAGCCTGGACTG
CGggcgatggtgttggcgAAGTCGATTCGTTCCTGAAATACGATCCGAATAGAAGCAATCGCGCGATTAGCTATTTTTTCGCGACTTCTGATGCAGTTCG
GCAGGGGTGATGGGAATAAGAGGTAGACAGCTTTATATATTTGCTAGTAATACAAAGATTGGCATGTAGTCGTTATCGCAGGTGAtcaagagaagaaggt
gcaTATGATGCCGGTGCACAGCATGGAGTGTGTTCCTGCTGGTGAGTCAACATGTTTTGCTGCCGATCTGAGCAGCCTGTATTagagctccagctgctcg
atAACGACGCAACCTTACTTGTATCAGATGGCATGGCTTCAGCGCCAAGTTATCCGTGGATTCGGGATGGCTGCGCTCACGAGTCTCCAGCACATGGCGT
TTCGAGCGAGGGCGGCAAGAGTGGCTCAAGGCAGCTTGGCAACATGCTCAAACTTTGTTGTGGAGCTGAATAACCGGAGCCTCGCGCGCTCTCTCCGAAG
TGTAGTTATAGATTTCGCCGCCGTTTCGAAAATTTCGGAACGAGCGCAAAAGTATCCAAGATTTTTGCTGGACGCGCGCTAACGACTAAGGTATCCATGT
ACGTCGCGAAGCGATGGACCAAGCTCTCCGCGCACGGGTTGCAGAGGTAACTGCCCAACGAGGCGAGCGCGTATTCACCCGCTGCTGCTTATGCCCAAGC
GCAAGTTGGAAGTCAGAGAAACGCGATGCCGAATGTCTCCGAGAAGTGTCAAATCCCAAGGCACTGCGTACGCCATCTTCGTTCTATAGAAATCCTGCGA
CGAGGAGGGAAGATGCTACCCGACAGGTACAACTCGATCGGGTACCTGTTCCACGGATCGGTTGGCCCACAGCGCCCGCGACAACTTGTCTGGACATGTT
TTGCTGGATTTCATAAATTTCCTCAAAAATTACATTGCAATTTCGGTGTAAACGAACTGAATAGTATCTAGGTGGTCGTAACGTCTCGCCAATCGTGCCA
AGATCACGCATCAATAAGGGCTGCATGACTTTGCTGCCTTGACATTGCATTGACATTGACGCTTTACCCGTGTACTTACTGCTCCTTCGTCCGGCGCTAA
AGTACAACTAAGGTCATGACGGTATTAATCGAGCGTTGAGTGCCGAGGACAGCGCCTCCAACCCTTCCTGGCCGATGAAattgtcctgcagcagcagcgt
gcgcAGCTGGACGGCTGGTTCGTCTGGTCTCCTCCAGTTTGGTTTAACTTCGTggctcgagcagcatccgCCGTGGGTATGAAGAGGTTGAGTCGATTTG
AGATCGTCCGCACGACAAGAAATCCAGTCGGCCAACGCGAGCGCGTCCAGATCGGTGAGAATGTTGCcgctcacgtccagcaccCGCAACGATGGTAAAC
ATCGTAGTATGCGTAGCAGCGCCTGACAACCGGCCTCGCCGATGAAGTTGTTTCGCAGCACGAGCGTCTTTaacgagctgaagcagttTACGCAGTTGCG
AGTTGCAGTTTGTTGTTCGAAGACATCCGCCAGACGGTTTAAGCGCGCGTCGCCCAGGTAAGTTGAGTCAAGGCGAAGATATCGGAgctttccagcagca
gttgtcGATCTCTGAGTCGCGAAGGCTTCGAGACACCTAAGCACGTTGTCGCTTTCTGCGAAATAGTCGAGGGGTGAACCCAGGTTCATTTCCTGCAGTT
CAGGACATGCTCCTCGCTCAAACGCACACGTGATGTCTCTCAGCACGAGTTCACCCGCAAGTAAACCATTCTTGAGCATACTGTCTCGATGTGACGGGCG
ACTGAAAGAGGGTCGACGATGTACCAATTTTCGACTGGTTTTACTGACTGCAGATTCGTCCCCAACTTCTCGCATCTTGCTCGTCACCACCAGACTGGTG
AGCTTGCTGcaacgaagcagcaacgtcgtcaGTGCACCACTCgagaaatgctgcaacgcTGGCGACTGCGTCTCGAGATGCAGCGTACTCACCATCTGTG
GAGCGTTCTCCCACATGAACCTGTTCACCGAGCGCAACCGAAGCACCGTACGACCGGACAGGAAGCTCAGTACGAGTCCCACCAGATTGTCGTCGTTTTC
CAGCAGAAACACACTCCTGTCCGCCAATGGGGCTATTGCCTGTTTGTCCAGACGTTGCCGTCTCTTATCAGGACTGTAGTCGTCAACTTCGATACTTTCT
CGTTCCCgtttggtgctgctgttgctgttgctgtgacCTTCCTGTCGAGGAACCACCTTTGGCCCCAGCTGCGTGACGAGGGCCTGTACTCTGCGTTCCA
AGGAATTTTCATGGGTGTACTCGTGCATCGAGTGGGCGGCGTTGTAGAGCATCCACTCGAGTCTCTGCACCAGTGAAGGCACCGCGACGGAGCTTCCGTT
GCTGTCGGTGGTCGTGCACTCGGTCCCTGAGAGCACCGGAtgcagtcgtcgcagtctcAGCATCATGTGTTTGCGCATCAGTCTGTCGTCCACATTGTTG
TGCCACGACCGACCTCGGGGGATCGCGTGGGGCAGCACCTGCATTGCAGAAGTCGACGAGGAGTGCTGAGGCATCCATGCAGAGCCTTGCTGAGGCGACG
TGGCACGCTCCCAGACAATTGGAGAATGACCTGCACAGGTCTACCATCGATGCCGGTCGTAGTGGTCAGTGGGTTGGAAACGAGTGTCTCGAAGCAGATG
CCTACAATCCGGTAGAGTTGCAGCGATAGGCCGTTGTACGTCATGTGCATGTACCCACCCGGAAGCACTTCGAAGTTCGAAGTGCAAAGCGCCATGGATC
ACCGTCCCATGCTGCTAGCTTCATATATCTCGAACGGTTTTCGTAGTTTGCACCGGGCCGTTCTTTCGGGGGCACAGATCGGTACGTATCGAGTtgccac
cgcagcaactcAGAACGTAAGCATGATGGAAGTTGGATATCGAGTAGTGAGTTGGATGTCGCTACGGTCGTGCAGAGAGCAGCGGACACCTAGTTGCGGC
ACGATTTTCTGAGCCTAAATACGTCATGACCACAGGCCACGCGGAAACTGCATCATTTGTAGCTTGTAAACCTGACTAATAAGCCACCGTGGACACGTGG
tacggcaacggcaacagTACCTTGGGACAGgcatggctacacttttgCTGCGGATGACAACCAGTCAAGAGGTAGCCTCGAAACAAAGCTCTAGATTTCG
CTGCATCTAGGTGGGGTTGACACCAGCTATGGTTCTATGACGTCGCTATCGAAGGGTACACTTCTCCGAGTACTATGCAAGCTGTGCTTCATCTGGTAAA
AGTGTATCCTAAGAACCTCTTAACACCCAGTCTCTGGCTCAACCGGACCACGCGTCTGGAAGTccaaaaaaataaaaaaaatcactGGGCTGAATTGGAC
GCTCAAATTCGCACACATGGGGTGTATGAGTCTTTTAATAATGTCTACGTGCTTTGAGAGCCCTGGTGACTCTACAAGACAAATAAATGGTCATTGTATA
GCAGCATCTCGCTTCAATAGCTGCTCCTGCCTTGCTTGTGGTCATCGCTGTTGGACCTATCCCTATGCGTATAAAAACGCCTGTGGTTACATGTATATAA
CCCAGCGGCGTGGCCTCCGCAAGAAGTGCTCCGACTGCACACTGTCGAAGACTTGCTGCACCCcgtacacgtccacagcCACGAAACGATTGGTGCCGTC
GACTCCAAATTCTACAGACACGAAACTACTGGTTTGAGCGGGCGACGGTCTCTGATCTGTCTAAGTATTCCCCAGCGTTCTCTTTTGCGTGCGGTCCGAC
ATAGGCATTTCGACTTGACCCAGGCTCCAGATCTGTGCTAAGAAACGCCCCATCTTATCGTACGTAACgagcccccccccccgaGAATGCAAGACTGCCT
GGACGAtaacaagatgctggacgatatCGTCTTGATTGAAGGCGGTCCGGACGAAGGCCCCTCAGCTGAAGATGTTCTCGTTGAAAGTGTTCCAGATAAA
TCACCGTGTACAAGTCCACATATGGGCCGGTGtattcaagaag