Description :
From Genome Similarity Track
Location :
Scaffold_2063:154- 2941
Sequence
2787 bases(100 bases per row)
AAATACGCGCATCCCCAAGAATTTCCTCACCTCGCCCAAGTCTTTCACGGACAACACGCTCATGGAGCAGAAGAAATCGTCCACCAGACTCGGCTTGGAC
GCGGTGACCAGGAGATCATCCACGTACACGCCCACGAGCGTCATCTCGCCGTCCTCTCGCTTGTAGTATAGGCACATGTCCGTCACGCACCGTGTGAACC
CCGCCTCCTCCAGCTTCGCGTGCAGGAGTTGACTCCACAGCCTGCCTGCTTGGCGTAGGCCGTACAACGACTTCCTCAAGCGCAGCGCCAGCTTACCTTT
GACGCTCACTCCGAGCCTGCGCATCACCTCATCTCCGATCACCATTCCCTGTGGGATCTCCAGGTAGATCTCGAGATGCTGCTCCTTGTCGGCCTTCACG
TACGCGTTGGGGATGTCCCCGTGCCTCGCCGGCACGCCCCAGCGACGAGCAAAAACCAGGATGACCTTCACCGTGCTCAGCTCCATGACCGCCGCGAACG
TGAGCCCGAAGTCCACGCCAAAGATCTGCTCGTTGCCGCACGCAACGAGCCTGGCCTTGAACCTTTCTATGGCTCCGTCTGCATCATTTGAAAACCCACT
TAGTGTGCAGTACGTGGCTGCCGATCGGTGGCACCACCACGACCCACACGCCGTTCTCCTCCAGCGCTTTGAGCTCCTCCGCGATGGCAACCAGCCATTT
CCTCCAGAGCTTGCTCCTCTTTGCCTGCCGGTAGTTCTTCGGGTCGGGCTCCCGCACGCTGTTCACCACGTCCGCGGTCTGTTCCACCCGATCCTCATCA
GCGCCTCCACTCGCCACCGCCTCAGCGAAGCCGAGCGCGTCTGATGCCTATCCCGCGTCCAGCGAGATTTCTTCCCGCGACGCTTCGCCTTTTCCTTCGT
CTTTGTCCTCGAAGTGTCTGTCTCCAAAGCCCCGTGCCCTCCGACTCCTCGGAGTCCTCCAGATGCACGCGCTTCAATTGTTCGTTCTGCACGTCTGACA
ACGTCTCGACGTTGCTCACATGCTGCGTCACTACGACTACCTTATCCTTCGGGAGATACACCCAGTAGCCTTTAATCTCGTCGTTCTTTCCCACGATCAT
GCCCGCCTTGCCCCTCTCACCCAGGGACTTGTTCTTTGCGTCCACGTGCACCGTACAGGGCGACCCGAAAACCACGATGTCACTCAAATCCGGTGTGCTC
TTCGTGAGCATCTGCAGTGGCGACTTCGATCCCGGGTTAGCCTTCGTCGGGCTCCTGTTTAGGATATAGGCTGCATATTCCGCAGCATCCCCCCAGAAAC
TAAGCGGAAGGCCACAGGCGAACACCATGCTCCGCACCACATTCATAACGGTGCGGTGCATTCGTTCCGCCTTGCCGTTACTAGCCTGGTTTCGCGGCTC
GCTAATCTGCCGCCTGATTCCGGTATCCTTGCAGAAGAGATCCAGGGTCTTGTATTCCCCACCACGGTCCGTCCTCAACACGTGTATGCGGCAGTTGAAC
TGCCGCTCAAAGTACGCCATGAAATGCTTAAACTTCTGTGCCGCGACGTCCTTAGTCTTCGCCAAGAAGACCCTGCAGTAGTTGGTGCGATGATCAACAA
AGTTGACCATGTATCGGTTCCCTAGTCGATCTCTCGGAGTCATCGGCCCCTTCAGGTCGGAGCAGATGACTCCTCCGATCACGTCAATGGGCGAGTTAGC
CCCGGTGTCCTTGCGCGACTGCTTCTTCTTGGTCTGTTTGCCTTGGGCACAAGCCAAGCAGTTCGCCCTCACCTCGTCCGTGAGTGCAATCCCGGATGCC
GGGTCCTTGGCCATCTTAATGATCGTGTCGTAGCTCAGATGCCCTAACCTACGGTGGATATGCATGAGCGGCCCGGTCTGCACGTCCCTGCCGACATCCG
CCTCACCTTCCGCCAACACCGACATCAACACGTTGCCCTTCCGCCCCGTGCCTCTGGACTCCATTGCACGCACTGTGAGAACGTTGTTTGTCTTCTCGAC
GTCAAACACCGCCGGCCCGCCGTTGATGCCGGCTACCACGCGGTGCTTCCCTCGGTACGCGAGTCCGTACCCCTTCGCCTCCAACAACCCGTACGATATG
ATGTTCCTTTCCAAGTTTTCCGCGTACTGCACGTTCAGCAGCCGCACTTTGGCATTCTTCCCCATCGCCGTGGTTACGAGCATTACGCTCCCGCGCTTAG
TTACTTTTAGCGCTCCTCCGTCCGCTGCCACGCATTGACTTTCGTAGTCTTCCGCGTCTTCCAGCAGCTCCGGATCATTCACCAGATGACGGCTGGATCC
AATGTCCAGGATCTAGTCCTCCGTCTCTGTGGCCGACTCCTCGACCGTGAGCACGAAGTCAGCGTCCGTGCCTTCGCCCCACCTCTTCTTCTTGTTCGGA
CAGGCCGCCCGCAAGTGGCCAGATTTACCACACTTGTAGCACTTGCGGTCGTCCTTCTCGTCCTCGTGCACATCGTTGACCACGTCTCGCCCCAGTAGCT
TGCCTCGCAGCTCGATCTCCGTCGACTGGGCGAAGTGCGTCAGCTCTTCCGCTTGGCGCAGGTAGTCCGTGCGTGCCAAGTTCAGCCTGGACAGCATCGA
CACTCGCATGTTCGGATCCGCGTAGTGCACGATGTTGTCAAGGACCAGGTTGTCCGCACCGCCGCACGCCTCGCTAACTGCCACGAGGTATAGGTAGTGC
TCTGTCCAGCTTCTCTTGGAGCTCTTCGGTGCCGTGAACATCTTCATGCTCTGCGCGGGTGTGATCTTCGTGGCGAAGGTGTGCAGT