Description :
From Genome Similarity Track
Location :
Scaffold_1707:154- 2364
Transcript NameFunction/comments
Phyag_g11306hypothetical protein PHYSODRAFT_356115

Sequence
2210 bases(100 bases per row)
ATGGGGGCGTACGAGGCGCTGTCCTTGACACAGAGTGCGCAGGTGTATCTGCTCGTAGGCGGATTGAGCCTGATCCTATACTTGATCCTAGTATTGTCCT
ACTTCCTCGTGCCCAACATCAAGGCGCAACATCCAGCCGCCGACCTCGTGGTGTGGCACGCAGGCTGCGGATTGATGACGTCCCTCGGTTTCGTGCTCGc
cttcgcgctgcagcggcaggacgaggatgacgaagacagaGAGCTGATCCACTGGCAGTGCTCCGTTCTAGCTCCGTACAaccagttcttcttcctgtca
ggctgctgctggtaccTCATGCTCACGCTGGAcctgctcgtggcgctcgtgaaCCCCTGGATGGGCTACAGCTGCAAGTCCTGGGCCTACCACACCATGT
AatttattattattattatatTGTAGGATATAGTAGACTGACTCCTCCTGTGTGTATTTGTTGTCTATTGTGGCAGAGTGTGGAGTGTGAGTGCTGTGTc
ggcgttgttgttgtatcAGCTGGAGCTTTTTGGGCTTTCCCCGCTTAATGTGTGCTGGGTTAAACGCACACACGACCCGATGTGGGTAAATACGGCAAAT
TGGTTTTTTTTATTCGGCGTTGTGGGTGGCACCTGCGTGCTGTCgtgtgctgtgctgctgttcgcgaGCTTCCGCTTCGTGCGGCGTCAACTGGATGTCA
CGTATCGTGCCAAACGCCGCAATTTGATTCAGTATTATCGGTACCTGCTGATCTTTGCTGGACATTGGGCGGCCTGTGGCGCATTGTACTATGCAGCGTA
TCGCCAGCAGTTTGACGGAAAGATGGCCAAGCATTTTGAGCTCGCGTTCGCGCTGGTTTTTGGATCCTATCCGGTGCTGCTACTGATTGTGTGGGTGCTG
AATACGGAGCTGTACCAGAATTTTTCTAGTGAAAATAATCTGTCCAAATCGgagcgaggagctggagactcGACGAGTACGGAGCATTTCAGTGTTGCAC
TGCGTAAAGATTTGATGCGATACACAACTGCAGGGATCCGATGCAGTATTACCGAATCTCCTGCAGATAGTTTACGCTCGCCACTACTAAGTCTGACGCG
AGATCGGTTTGGGTCGTTGGATCGCacggcggcgctgtcgtTTTTGCAAATGGAAGAGGGTGACTCGGCCGGTTTGTACCACGAGAAGAAACGGTTGGCG
ACTACGGTTTACAATGGTGAGTATCGGTACTACGAGAAGCTGGGCTTCACCGACTATGCGCCCAAAGTATTCCAGAACATTCGCGAGATCTGCGGCATCG
ACAATGAAATGTACGAGCAGTCGTTTGCTGATACGCTTCTCGAGCGCGCGTCAGAGGGCAAGTCGGGGATGCTCTTCTACTTCACCAGCGATCGTAAGTA
CTTGGTGAAGACTATGACCAAGAAAGAACAttcgtttcttcttcgggtgCTTCCACTGTTCCATCAGTACATCCTGAAGCAGCCGAACTCACTCTTGTGT
CGCTTCCTAGGCTGCCACTCGATGCAGCTTCCCGTTGGGTGGAACAAGATGTTTTTTGTCGTGATGGAGAACATTTTTCCGGATGGCCCGGTCGACGAGC
GATACGACCTTAAAGGTATTTTCCACCAGTCCAACTTCAGATACCAGGAAGGAATCCCGACACCGGTGTCGAGCGAATGGAGTAGGAGTGGTAGGGAAGA
CGAAAGGGGTATCCATATACTGAATGAAGACGCGTCGAGCGAGAGCCAAAGCGTGGACAGTGAATTGGGACACGTTACTGAGAACGAGCCTCTGCTGCGC
CGCAGCTCACGTCCCATGCTCCGATACGACAATGACTTCGTAACTCGCCGAGCCTCACTTGTTGTGAATCCAACGACCCGTGCGAACCTGCTCGCGCAGC
TGACAAGTGATTGCGGGTTTCTCCAGGAGCTGGGCATCATGGACTACAGTTGTCTACTCGGCATCCGACATTACAATAACCGCATTGAGCCCGATGTTAT
GGATAACCTGGCGCACAATGCCGTCGTGTCGGCCGACCAAACTACCGTGTACTACCTCGGCTTTGTGGATATCTTGCAGCACTACAACATTGGGTGGAAA
ATGCAGCACTGTTTGCTGGCTGCGGTTGTCGATAAACGCCAAATCAcggctcttcctcctgctgaGTATGCACTGCGATTTTTGAACTTCATCCACGAGT
ATCTGCTGCG