Description :
From Genome Similarity Track
Location :
Scaffold_3115:154- 1200
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3115-snap-gene-0.1DEAD box helicase

Sequence
1046 bases(100 bases per row)
TACCCACCACTAAGGCTGAATTACAAAATCAAATGAATGCACGTGCTTTTTTCTTCTATATTGCAAATTTAGTTACATAAGTGGGAGATTCTGCTGGCTT
TAATGAGCAAACTGGCGCTTGTCGTTTGCCGCGCGCTTCCCGTAAGGATTATCCGAGCTGAAGGCGTGACCCGAACGTTGGAACCGCTTTCTCGAGTTAC
CTTCGTCGTCAAAGCCCCCAGCTTTTCGTTTGCCCGTCTTTCCACTCGTCTTGACTGGCAGCGTCACCTTCGGCGGAACGACAAGACCAAACGATTTCGC
GACGGCCTGCAAGTCTAAGCTGCCCACATCGAAAATATTCTTGAGAGCGTGGGAAGCGTAGGCAAGCAAGTAGCCACGGTACGCGTCTTTGGCGGACTTG
TGCAGATAGTACGTCTTCTCCACGAGCTTCATCAGTTGGGATTCGACGTTTGCGATCTTGTTCAATGGGAACTCATACTCGTTCAAGGCGACCTTGGCAG
CCTTCAAATACTTCAGGAAACCCAACTCCTCAGGCAACAGCATCAAAAGGGCTTTACCTTTGCCCTTAGCACCACGAGCAGTACGACCGACACGATGGAT
ATATTCCTTTGGATCATCTGGTGGATCAAACTGAATGATCCAGTCCACAGCAGGAATATCGAGACCACGAGCGGCAACATCCGTACACAGCATGATACCG
GTTTTCGCGTTACAGAACTGGAAGAACGTCGTCGTACGCTTGTTTTGCTTCTGTTTGCCGTGGATGTCCATCACCGGAATGTCAATGTAGTTGAGAAGCT
CTCCATAAAACTTGACCGCGGCGCAGGACGAAAAGAAAACCATGACTTTCTTCTTCAAGTTTTTCTTCAAGAACGTAAAAAGAAGCAAGAAACGCTTGTC
ACTTGGAGTAACCACGTAACCTTGTTCCAACGTGGCCACTGTGGCCTTCGCATCTTCTTCTTCGACACCAACGTACACGGGCTTCTCCTTGATGGACAAG
CGCGCCAAATCTTCAACCTTCTTCGTCTGTGTGGCACTAAACAACA